FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634862_at:

>probe:Drosophila_2:1634862_at:155:477; Interrogation_Position=133; Antisense; GTTTTTATATCGGTTTGCACCGCCT
>probe:Drosophila_2:1634862_at:594:623; Interrogation_Position=158; Antisense; TCCTGGGCGAAGGTCTTACATGGGT
>probe:Drosophila_2:1634862_at:570:473; Interrogation_Position=273; Antisense; GGACTCCCTGGACAAAGCGGTAAAG
>probe:Drosophila_2:1634862_at:603:299; Interrogation_Position=340; Antisense; CGCGATCTCTCGCTTGTCAAGATGA
>probe:Drosophila_2:1634862_at:239:651; Interrogation_Position=392; Antisense; TCACCGCCCTGTTGAGTATGTTCAA
>probe:Drosophila_2:1634862_at:490:481; Interrogation_Position=407; Antisense; GTATGTTCAACAGCATCTTCGACGG
>probe:Drosophila_2:1634862_at:655:161; Interrogation_Position=492; Antisense; AAATTTGTCCGGTGACGACTATACG
>probe:Drosophila_2:1634862_at:399:403; Interrogation_Position=508; Antisense; GACTATACGGACTGCTCCTTTATAT
>probe:Drosophila_2:1634862_at:723:699; Interrogation_Position=526; Antisense; TTTATATTCCTCTACATCCTGTGCA
>probe:Drosophila_2:1634862_at:717:595; Interrogation_Position=545; Antisense; TGTGCACCATGTCCATTCGTCAGAA
>probe:Drosophila_2:1634862_at:528:173; Interrogation_Position=576; Antisense; AAAGCTTCTGGGTTTTGCCCCATCG
>probe:Drosophila_2:1634862_at:269:45; Interrogation_Position=597; Antisense; ATCGCGCGCCGCAAGCAAGCAGGGT
>probe:Drosophila_2:1634862_at:517:601; Interrogation_Position=621; Antisense; TGTAGGTCTGTTTGGTCCTGCTCCA
>probe:Drosophila_2:1634862_at:182:335; Interrogation_Position=640; Antisense; GCTCCAGGCCAGTTCAAATAGTTCA

Paste this into a BLAST search page for me
GTTTTTATATCGGTTTGCACCGCCTTCCTGGGCGAAGGTCTTACATGGGTGGACTCCCTGGACAAAGCGGTAAAGCGCGATCTCTCGCTTGTCAAGATGATCACCGCCCTGTTGAGTATGTTCAAGTATGTTCAACAGCATCTTCGACGGAAATTTGTCCGGTGACGACTATACGGACTATACGGACTGCTCCTTTATATTTTATATTCCTCTACATCCTGTGCATGTGCACCATGTCCATTCGTCAGAAAAAGCTTCTGGGTTTTGCCCCATCGATCGCGCGCCGCAAGCAAGCAGGGTTGTAGGTCTGTTTGGTCCTGCTCCAGCTCCAGGCCAGTTCAAATAGTTCA

Full Affymetrix probeset data:

Annotations for 1634862_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720