FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634863_at:

>probe:Drosophila_2:1634863_at:650:131; Interrogation_Position=1002; Antisense; ACCCCAACTTTGCAGCTTCAAGATT
>probe:Drosophila_2:1634863_at:470:285; Interrogation_Position=577; Antisense; CGCCTGGAAAGAGTGCTGGACCTGC
>probe:Drosophila_2:1634863_at:603:63; Interrogation_Position=619; Antisense; ATGGTAGAATCCTGCCATCTTGGCA
>probe:Drosophila_2:1634863_at:598:357; Interrogation_Position=641; Antisense; GCAACGATGTAGCTATGGCCCTGCT
>probe:Drosophila_2:1634863_at:569:577; Interrogation_Position=657; Antisense; GGCCCTGCTACTCACCATAATGGGA
>probe:Drosophila_2:1634863_at:623:371; Interrogation_Position=714; Antisense; GAAGGAATATGCTCTCAAGGCTTTT
>probe:Drosophila_2:1634863_at:401:297; Interrogation_Position=746; Antisense; CCAAAACGGTCAACTGGCGCCAGTT
>probe:Drosophila_2:1634863_at:654:583; Interrogation_Position=780; Antisense; TGGACGCCAGGCAGATTTGTTTATG
>probe:Drosophila_2:1634863_at:645:19; Interrogation_Position=794; Antisense; ATTTGTTTATGCTCATCCGCACTTT
>probe:Drosophila_2:1634863_at:271:633; Interrogation_Position=809; Antisense; TCCGCACTTTCAGCATGATCATCAA
>probe:Drosophila_2:1634863_at:484:395; Interrogation_Position=871; Antisense; GACAATCTGGGTGCCGAGATACACA
>probe:Drosophila_2:1634863_at:512:427; Interrogation_Position=886; Antisense; GAGATACACAAGTACTTCCTGCAGG
>probe:Drosophila_2:1634863_at:626:149; Interrogation_Position=899; Antisense; ACTTCCTGCAGGTGCGCATGGATCA
>probe:Drosophila_2:1634863_at:297:303; Interrogation_Position=929; Antisense; CCGCCTATGGCGACTTTGAAATGAT

Paste this into a BLAST search page for me
ACCCCAACTTTGCAGCTTCAAGATTCGCCTGGAAAGAGTGCTGGACCTGCATGGTAGAATCCTGCCATCTTGGCAGCAACGATGTAGCTATGGCCCTGCTGGCCCTGCTACTCACCATAATGGGAGAAGGAATATGCTCTCAAGGCTTTTCCAAAACGGTCAACTGGCGCCAGTTTGGACGCCAGGCAGATTTGTTTATGATTTGTTTATGCTCATCCGCACTTTTCCGCACTTTCAGCATGATCATCAAGACAATCTGGGTGCCGAGATACACAGAGATACACAAGTACTTCCTGCAGGACTTCCTGCAGGTGCGCATGGATCACCGCCTATGGCGACTTTGAAATGAT

Full Affymetrix probeset data:

Annotations for 1634863_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720