Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634864_at:

>probe:Drosophila_2:1634864_at:208:207; Interrogation_Position=1376; Antisense; AAGCTGCTGGCGAAGTAAGTTCTGC
>probe:Drosophila_2:1634864_at:471:371; Interrogation_Position=1387; Antisense; GAAGTAAGTTCTGCCTGTTGCCTGG
>probe:Drosophila_2:1634864_at:154:603; Interrogation_Position=1402; Antisense; TGTTGCCTGGGTTCACATTCCGGGC
>probe:Drosophila_2:1634864_at:527:411; Interrogation_Position=1430; Antisense; GACCGTAAATGTCAGAGGGAACCAT
>probe:Drosophila_2:1634864_at:276:129; Interrogation_Position=1450; Antisense; ACCATTGTTCCGCAAATTATTCGAG
>probe:Drosophila_2:1634864_at:228:15; Interrogation_Position=1465; Antisense; ATTATTCGAGAATGTTGGAAGGCAC
>probe:Drosophila_2:1634864_at:343:561; Interrogation_Position=1481; Antisense; GGAAGGCACATTCTTGTATGTTAGT
>probe:Drosophila_2:1634864_at:210:485; Interrogation_Position=1496; Antisense; GTATGTTAGTTGATCGTCGCAGAAA
>probe:Drosophila_2:1634864_at:267:639; Interrogation_Position=1509; Antisense; TCGTCGCAGAAAGCTACAGGAGTAT
>probe:Drosophila_2:1634864_at:453:231; Interrogation_Position=1592; Antisense; AATGATTTTTAACTGGTAGCATAGA
>probe:Drosophila_2:1634864_at:350:395; Interrogation_Position=1615; Antisense; GAAATGCTGGCTTTATAAATGGACA
>probe:Drosophila_2:1634864_at:354:169; Interrogation_Position=1631; Antisense; AAATGGACATTGGATCGGATTGGCA
>probe:Drosophila_2:1634864_at:210:543; Interrogation_Position=1647; Antisense; GGATTGGCATTACCATTTCGCCCAT
>probe:Drosophila_2:1634864_at:210:19; Interrogation_Position=1661; Antisense; ATTTCGCCCATATTATATTACATTT

Paste this into a BLAST search page for me
AAGCTGCTGGCGAAGTAAGTTCTGCGAAGTAAGTTCTGCCTGTTGCCTGGTGTTGCCTGGGTTCACATTCCGGGCGACCGTAAATGTCAGAGGGAACCATACCATTGTTCCGCAAATTATTCGAGATTATTCGAGAATGTTGGAAGGCACGGAAGGCACATTCTTGTATGTTAGTGTATGTTAGTTGATCGTCGCAGAAATCGTCGCAGAAAGCTACAGGAGTATAATGATTTTTAACTGGTAGCATAGAGAAATGCTGGCTTTATAAATGGACAAAATGGACATTGGATCGGATTGGCAGGATTGGCATTACCATTTCGCCCATATTTCGCCCATATTATATTACATTT

Full Affymetrix probeset data:

Annotations for 1634864_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime