FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634866_at:

>probe:Drosophila_2:1634866_at:50:343; Interrogation_Position=1101; Antisense; GCTTCTGGCTGCAAGTCGATTTTGG
>probe:Drosophila_2:1634866_at:588:221; Interrogation_Position=1128; Antisense; AAGGTCCTGCTCTACGGCAAACCAA
>probe:Drosophila_2:1634866_at:678:239; Interrogation_Position=1151; Antisense; AATAATCGCAGACTCCCAGGATACT
>probe:Drosophila_2:1634866_at:192:79; Interrogation_Position=1168; Antisense; AGGATACTGACCAAGTCCTTCCAGT
>probe:Drosophila_2:1634866_at:698:475; Interrogation_Position=1218; Antisense; GTTTACGTTTTAGACAATTCTGCAA
>probe:Drosophila_2:1634866_at:707:395; Interrogation_Position=1230; Antisense; GACAATTCTGCAAACCAGTCGTGAT
>probe:Drosophila_2:1634866_at:255:147; Interrogation_Position=1279; Antisense; ACTATTAGGCTAGCATCCGTGGAAT
>probe:Drosophila_2:1634866_at:494:347; Interrogation_Position=1291; Antisense; GCATCCGTGGAATATCAGCAAACAA
>probe:Drosophila_2:1634866_at:423:231; Interrogation_Position=1341; Antisense; AATGTTTTATTCCTGTGTATCGTAC
>probe:Drosophila_2:1634866_at:81:681; Interrogation_Position=1379; Antisense; TATGGCCAATACTTTGCTATTTTTG
>probe:Drosophila_2:1634866_at:197:341; Interrogation_Position=1394; Antisense; GCTATTTTTGTACTACCATATGTGT
>probe:Drosophila_2:1634866_at:499:399; Interrogation_Position=1522; Antisense; GACAGCATTCAACCACGATATTAAG
>probe:Drosophila_2:1634866_at:117:185; Interrogation_Position=1635; Antisense; AAAATTATTGTTCTGCTATCTTAAA
>probe:Drosophila_2:1634866_at:20:107; Interrogation_Position=1676; Antisense; AGAATGGGAATTACTATACTACTAT

Paste this into a BLAST search page for me
GCTTCTGGCTGCAAGTCGATTTTGGAAGGTCCTGCTCTACGGCAAACCAAAATAATCGCAGACTCCCAGGATACTAGGATACTGACCAAGTCCTTCCAGTGTTTACGTTTTAGACAATTCTGCAAGACAATTCTGCAAACCAGTCGTGATACTATTAGGCTAGCATCCGTGGAATGCATCCGTGGAATATCAGCAAACAAAATGTTTTATTCCTGTGTATCGTACTATGGCCAATACTTTGCTATTTTTGGCTATTTTTGTACTACCATATGTGTGACAGCATTCAACCACGATATTAAGAAAATTATTGTTCTGCTATCTTAAAAGAATGGGAATTACTATACTACTAT

Full Affymetrix probeset data:

Annotations for 1634866_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720