FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634868_at:

>probe:Drosophila_2:1634868_at:358:123; Interrogation_Position=1017; Antisense; AGCGCCTTCGCAGCTAATAGTAGCC
>probe:Drosophila_2:1634868_at:302:87; Interrogation_Position=1045; Antisense; AGTGCGCTCACCTGGTCGAAATACT
>probe:Drosophila_2:1634868_at:664:171; Interrogation_Position=1095; Antisense; AAAGCACAACGGAGGCCTGTACAGA
>probe:Drosophila_2:1634868_at:446:473; Interrogation_Position=1132; Antisense; GTTACTGTGGCCACTCCGGGAAACG
>probe:Drosophila_2:1634868_at:5:135; Interrogation_Position=1154; Antisense; ACGCCAGTCACGCTCGATTTTATAA
>probe:Drosophila_2:1634868_at:185:663; Interrogation_Position=1176; Antisense; TAAACTATTTCACAATCCCACCATA
>probe:Drosophila_2:1634868_at:221:269; Interrogation_Position=1225; Antisense; CAGGCTGCCGTGCTACTAGTAGAAA
>probe:Drosophila_2:1634868_at:647:173; Interrogation_Position=1268; Antisense; AAAGCGTCGAGTGGCACTTTGTCCT
>probe:Drosophila_2:1634868_at:665:415; Interrogation_Position=1325; Antisense; GAGCCTTCTTCAAGCTGGTGCGAGA
>probe:Drosophila_2:1634868_at:143:507; Interrogation_Position=1342; Antisense; GTGCGAGACTACCTCATCACTAAAG
>probe:Drosophila_2:1634868_at:380:201; Interrogation_Position=1403; Antisense; AACCCTTCCGACAACGCATGAGAGA
>probe:Drosophila_2:1634868_at:471:143; Interrogation_Position=890; Antisense; ACTGTATCATTGTGTGCCTGGGCGC
>probe:Drosophila_2:1634868_at:171:509; Interrogation_Position=926; Antisense; GTGCTGTTTTTCTATATCCTGCCAA
>probe:Drosophila_2:1634868_at:99:665; Interrogation_Position=965; Antisense; TACATCGGGCTACTTTACATTTGGG

Paste this into a BLAST search page for me
AGCGCCTTCGCAGCTAATAGTAGCCAGTGCGCTCACCTGGTCGAAATACTAAAGCACAACGGAGGCCTGTACAGAGTTACTGTGGCCACTCCGGGAAACGACGCCAGTCACGCTCGATTTTATAATAAACTATTTCACAATCCCACCATACAGGCTGCCGTGCTACTAGTAGAAAAAAGCGTCGAGTGGCACTTTGTCCTGAGCCTTCTTCAAGCTGGTGCGAGAGTGCGAGACTACCTCATCACTAAAGAACCCTTCCGACAACGCATGAGAGAACTGTATCATTGTGTGCCTGGGCGCGTGCTGTTTTTCTATATCCTGCCAATACATCGGGCTACTTTACATTTGGG

Full Affymetrix probeset data:

Annotations for 1634868_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720