Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634869_at:

>probe:Drosophila_2:1634869_at:232:603; Interrogation_Position=1098; Antisense; TGTTCGTGTCGCAGGATCCCGTCAA
>probe:Drosophila_2:1634869_at:358:669; Interrogation_Position=1145; Antisense; TACGGAATTCCCAAGCTGCTCAAGA
>probe:Drosophila_2:1634869_at:133:335; Interrogation_Position=1159; Antisense; GCTGCTCAAGAAGGCTGGACTCACG
>probe:Drosophila_2:1634869_at:463:557; Interrogation_Position=1175; Antisense; GGACTCACGCTGAAGGACATTGACT
>probe:Drosophila_2:1634869_at:360:557; Interrogation_Position=1189; Antisense; GGACATTGACTCGTGGGAGATCCAC
>probe:Drosophila_2:1634869_at:401:471; Interrogation_Position=1219; Antisense; GTTCGCCGGACAGATCGTGGCCAAT
>probe:Drosophila_2:1634869_at:556:237; Interrogation_Position=1241; Antisense; AATCTGAAGGCCCTGGACTCCGACT
>probe:Drosophila_2:1634869_at:525:145; Interrogation_Position=1257; Antisense; ACTCCGACTGGTTCTGCAAGACTTA
>probe:Drosophila_2:1634869_at:552:249; Interrogation_Position=1273; Antisense; CAAGACTTACTTGGGCCTGAACGAG
>probe:Drosophila_2:1634869_at:78:155; Interrogation_Position=1462; Antisense; ACAGGGCGTGGCTATGCTCATTGAG
>probe:Drosophila_2:1634869_at:548:257; Interrogation_Position=1501; Antisense; CACAGCCGACTGAAATCGCCAATTA
>probe:Drosophila_2:1634869_at:239:463; Interrogation_Position=1559; Antisense; GATTGCTAGCTTTTATACACCTTAC
>probe:Drosophila_2:1634869_at:102:667; Interrogation_Position=1574; Antisense; TACACCTTACAACTACGTCTATACG
>probe:Drosophila_2:1634869_at:115:101; Interrogation_Position=1641; Antisense; AGAGCACCAGCCTTTCAAACAATCA

Paste this into a BLAST search page for me
TGTTCGTGTCGCAGGATCCCGTCAATACGGAATTCCCAAGCTGCTCAAGAGCTGCTCAAGAAGGCTGGACTCACGGGACTCACGCTGAAGGACATTGACTGGACATTGACTCGTGGGAGATCCACGTTCGCCGGACAGATCGTGGCCAATAATCTGAAGGCCCTGGACTCCGACTACTCCGACTGGTTCTGCAAGACTTACAAGACTTACTTGGGCCTGAACGAGACAGGGCGTGGCTATGCTCATTGAGCACAGCCGACTGAAATCGCCAATTAGATTGCTAGCTTTTATACACCTTACTACACCTTACAACTACGTCTATACGAGAGCACCAGCCTTTCAAACAATCA

Full Affymetrix probeset data:

Annotations for 1634869_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime