FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634870_at:

>probe:Drosophila_2:1634870_at:181:645; Interrogation_Position=103; Antisense; TCTACTTTCGGACTCTATCCAGGAT
>probe:Drosophila_2:1634870_at:28:637; Interrogation_Position=116; Antisense; TCTATCCAGGATCAGGTGGACCTTT
>probe:Drosophila_2:1634870_at:524:79; Interrogation_Position=129; Antisense; AGGTGGACCTTTTGCTGGCGCCTAT
>probe:Drosophila_2:1634870_at:154:683; Interrogation_Position=151; Antisense; TATGCTGCTGGTCCCTTTGCTGGCG
>probe:Drosophila_2:1634870_at:126:695; Interrogation_Position=166; Antisense; TTTGCTGGCGCTCCTTTGGTTAATC
>probe:Drosophila_2:1634870_at:547:589; Interrogation_Position=182; Antisense; TGGTTAATCCTTTGGGTGCATCTCC
>probe:Drosophila_2:1634870_at:446:163; Interrogation_Position=20; Antisense; AAATGTTGATTCTCGTATCCCTGGG
>probe:Drosophila_2:1634870_at:214:483; Interrogation_Position=214; Antisense; GTATCCAGCAGCCAGCGCTTGGACT
>probe:Drosophila_2:1634870_at:274:83; Interrogation_Position=227; Antisense; AGCGCTTGGACTACTTTAACCAGTT
>probe:Drosophila_2:1634870_at:493:709; Interrogation_Position=242; Antisense; TTAACCAGTTTAATGCCGCCTTTGC
>probe:Drosophila_2:1634870_at:574:401; Interrogation_Position=323; Antisense; GACTCATTCAGCCAACTCGTTTCCT
>probe:Drosophila_2:1634870_at:419:695; Interrogation_Position=342; Antisense; TTTCCTTGCTCCTGCAGTGGCAGCA
>probe:Drosophila_2:1634870_at:81:407; Interrogation_Position=44; Antisense; GACTGCTGGCCAGTGTGGCAGCCAA
>probe:Drosophila_2:1634870_at:184:595; Interrogation_Position=75; Antisense; TGTGGATCCAGCACTGTTTCCTTCG

Paste this into a BLAST search page for me
TCTACTTTCGGACTCTATCCAGGATTCTATCCAGGATCAGGTGGACCTTTAGGTGGACCTTTTGCTGGCGCCTATTATGCTGCTGGTCCCTTTGCTGGCGTTTGCTGGCGCTCCTTTGGTTAATCTGGTTAATCCTTTGGGTGCATCTCCAAATGTTGATTCTCGTATCCCTGGGGTATCCAGCAGCCAGCGCTTGGACTAGCGCTTGGACTACTTTAACCAGTTTTAACCAGTTTAATGCCGCCTTTGCGACTCATTCAGCCAACTCGTTTCCTTTTCCTTGCTCCTGCAGTGGCAGCAGACTGCTGGCCAGTGTGGCAGCCAATGTGGATCCAGCACTGTTTCCTTCG

Full Affymetrix probeset data:

Annotations for 1634870_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720