FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634872_at:

>probe:Drosophila_2:1634872_at:383:337; Interrogation_Position=1018; Antisense; GCTCCGCCAATCTTCTGTATGACAA
>probe:Drosophila_2:1634872_at:15:83; Interrogation_Position=1054; Antisense; AGGGATACTGCCTGGACACACAGCT
>probe:Drosophila_2:1634872_at:689:545; Interrogation_Position=1109; Antisense; GGATGCTCGAAACCCATTGATGCGG
>probe:Drosophila_2:1634872_at:463:433; Interrogation_Position=1134; Antisense; GAGTGGAGCATCTTGGCCATCCGAA
>probe:Drosophila_2:1634872_at:351:189; Interrogation_Position=1186; Antisense; AACAGGTGATCGCTGGCCTGACTAT
>probe:Drosophila_2:1634872_at:496:651; Interrogation_Position=1246; Antisense; TCAACCTGGACATGGGAGCGCTACG
>probe:Drosophila_2:1634872_at:7:341; Interrogation_Position=1265; Antisense; GCTACGCATCTCTGACAGGCAGTAA
>probe:Drosophila_2:1634872_at:247:479; Interrogation_Position=1292; Antisense; GTTTCGATGACCTAGCATACAGCAT
>probe:Drosophila_2:1634872_at:108:29; Interrogation_Position=1308; Antisense; ATACAGCATACGTCTACCCATGAGA
>probe:Drosophila_2:1634872_at:476:97; Interrogation_Position=1377; Antisense; AGATGTTATTCACACCACGTCATGC
>probe:Drosophila_2:1634872_at:389:275; Interrogation_Position=1422; Antisense; CTTTTCGGGCTTTACGATGCGCTAA
>probe:Drosophila_2:1634872_at:159:549; Interrogation_Position=903; Antisense; GGAGGCGGCCTTGATAAGCCCATGA
>probe:Drosophila_2:1634872_at:470:521; Interrogation_Position=942; Antisense; GTGGCACTCACTTCGGACATTGATG
>probe:Drosophila_2:1634872_at:149:633; Interrogation_Position=997; Antisense; TCAAAACGTTACTCGTACGCTGCTC

Paste this into a BLAST search page for me
GCTCCGCCAATCTTCTGTATGACAAAGGGATACTGCCTGGACACACAGCTGGATGCTCGAAACCCATTGATGCGGGAGTGGAGCATCTTGGCCATCCGAAAACAGGTGATCGCTGGCCTGACTATTCAACCTGGACATGGGAGCGCTACGGCTACGCATCTCTGACAGGCAGTAAGTTTCGATGACCTAGCATACAGCATATACAGCATACGTCTACCCATGAGAAGATGTTATTCACACCACGTCATGCCTTTTCGGGCTTTACGATGCGCTAAGGAGGCGGCCTTGATAAGCCCATGAGTGGCACTCACTTCGGACATTGATGTCAAAACGTTACTCGTACGCTGCTC

Full Affymetrix probeset data:

Annotations for 1634872_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720