Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634874_at:

>probe:Drosophila_2:1634874_at:249:365; Interrogation_Position=1074; Antisense; GAATTTCCGGAAGGCCTTCTACAAG
>probe:Drosophila_2:1634874_at:474:699; Interrogation_Position=1090; Antisense; TTCTACAAGGCCGTTAACTGCTCCT
>probe:Drosophila_2:1634874_at:94:709; Interrogation_Position=1103; Antisense; TTAACTGCTCCTCTCGATACCAGAA
>probe:Drosophila_2:1634874_at:485:107; Interrogation_Position=1124; Antisense; AGAACTACACATCTGATTTGCCGCC
>probe:Drosophila_2:1634874_at:469:127; Interrogation_Position=1180; Antisense; ACCACTGGACTCTAAGGGTCAGCAA
>probe:Drosophila_2:1634874_at:306:663; Interrogation_Position=1226; Antisense; TAAATACCCGGGACCAATCCATCAA
>probe:Drosophila_2:1634874_at:669:31; Interrogation_Position=1246; Antisense; ATCAATGGACTGCAAGCGACCGCTG
>probe:Drosophila_2:1634874_at:266:325; Interrogation_Position=1261; Antisense; GCGACCGCTGCATTGGATTTTTGCT
>probe:Drosophila_2:1634874_at:511:543; Interrogation_Position=1275; Antisense; GGATTTTTGCTCTTCGAATGACTAG
>probe:Drosophila_2:1634874_at:323:233; Interrogation_Position=1345; Antisense; AATGCTTGTCTGTATCTTTTGTGTA
>probe:Drosophila_2:1634874_at:670:417; Interrogation_Position=1375; Antisense; GAGCTACGATGCTTATTTATCTCTT
>probe:Drosophila_2:1634874_at:261:515; Interrogation_Position=1437; Antisense; GTGTATACAGGCTGCACTGTTTACT
>probe:Drosophila_2:1634874_at:655:361; Interrogation_Position=1538; Antisense; GCAATGTGTTATACAAGCTCCCTTG
>probe:Drosophila_2:1634874_at:578:117; Interrogation_Position=1553; Antisense; AGCTCCCTTGACGTAAGCCATATTG

Paste this into a BLAST search page for me
GAATTTCCGGAAGGCCTTCTACAAGTTCTACAAGGCCGTTAACTGCTCCTTTAACTGCTCCTCTCGATACCAGAAAGAACTACACATCTGATTTGCCGCCACCACTGGACTCTAAGGGTCAGCAATAAATACCCGGGACCAATCCATCAAATCAATGGACTGCAAGCGACCGCTGGCGACCGCTGCATTGGATTTTTGCTGGATTTTTGCTCTTCGAATGACTAGAATGCTTGTCTGTATCTTTTGTGTAGAGCTACGATGCTTATTTATCTCTTGTGTATACAGGCTGCACTGTTTACTGCAATGTGTTATACAAGCTCCCTTGAGCTCCCTTGACGTAAGCCATATTG

Full Affymetrix probeset data:

Annotations for 1634874_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime