FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634876_at:

>probe:Drosophila_2:1634876_at:339:373; Interrogation_Position=134; Antisense; GAAGTGCGAGGCCAAGCTCTCCAAA
>probe:Drosophila_2:1634876_at:265:117; Interrogation_Position=148; Antisense; AGCTCTCCAAAGTTTCAGCGCCCAA
>probe:Drosophila_2:1634876_at:320:199; Interrogation_Position=182; Antisense; AACGAGCACAGCTCCTGCGGGAGGA
>probe:Drosophila_2:1634876_at:137:23; Interrogation_Position=20; Antisense; ATATGCGGTCAATCGGTAGCAAACA
>probe:Drosophila_2:1634876_at:224:423; Interrogation_Position=219; Antisense; GAGAACAAGGCTTTATCCTCGGCCC
>probe:Drosophila_2:1634876_at:717:325; Interrogation_Position=244; Antisense; GCGAGCGATACAATCCCATAGGGAC
>probe:Drosophila_2:1634876_at:396:267; Interrogation_Position=260; Antisense; CATAGGGACTGCTTTACCACCTTGC
>probe:Drosophila_2:1634876_at:265:129; Interrogation_Position=278; Antisense; ACCTTGCCGAATCTGCCGACAGAAA
>probe:Drosophila_2:1634876_at:410:295; Interrogation_Position=294; Antisense; CGACAGAAAGTGCACCAGATGGGTT
>probe:Drosophila_2:1634876_at:695:97; Interrogation_Position=310; Antisense; AGATGGGTTCGCACTATTGCCAGGC
>probe:Drosophila_2:1634876_at:730:687; Interrogation_Position=324; Antisense; TATTGCCAGGCGTGCGCCTACAAAA
>probe:Drosophila_2:1634876_at:710:313; Interrogation_Position=351; Antisense; GCCATATGCGCCATGTGCGGCAAGA
>probe:Drosophila_2:1634876_at:166:385; Interrogation_Position=392; Antisense; GAACTACAAGCAGAGCTCAACGTGA
>probe:Drosophila_2:1634876_at:642:583; Interrogation_Position=62; Antisense; TGGAATGGTCACTCTGTTTTTGCAA

Paste this into a BLAST search page for me
GAAGTGCGAGGCCAAGCTCTCCAAAAGCTCTCCAAAGTTTCAGCGCCCAAAACGAGCACAGCTCCTGCGGGAGGAATATGCGGTCAATCGGTAGCAAACAGAGAACAAGGCTTTATCCTCGGCCCGCGAGCGATACAATCCCATAGGGACCATAGGGACTGCTTTACCACCTTGCACCTTGCCGAATCTGCCGACAGAAACGACAGAAAGTGCACCAGATGGGTTAGATGGGTTCGCACTATTGCCAGGCTATTGCCAGGCGTGCGCCTACAAAAGCCATATGCGCCATGTGCGGCAAGAGAACTACAAGCAGAGCTCAACGTGATGGAATGGTCACTCTGTTTTTGCAA

Full Affymetrix probeset data:

Annotations for 1634876_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720