FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634877_at:

>probe:Drosophila_2:1634877_at:123:167; Interrogation_Position=1034; Antisense; AAATGCCACAGACCCAATCCGGAGT
>probe:Drosophila_2:1634877_at:453:591; Interrogation_Position=1058; Antisense; TGGGTAACACACACACTATCGACGA
>probe:Drosophila_2:1634877_at:41:627; Interrogation_Position=656; Antisense; TGCCCCTGCCCAAAAGGATACTGAA
>probe:Drosophila_2:1634877_at:609:175; Interrogation_Position=683; Antisense; AAACGTCACAGGATCAGGACCCGTA
>probe:Drosophila_2:1634877_at:246:73; Interrogation_Position=698; Antisense; AGGACCCGTACGACCATCTGGAAAG
>probe:Drosophila_2:1634877_at:499:219; Interrogation_Position=720; Antisense; AAGTCGAGTCCGAAGATTGCAACTA
>probe:Drosophila_2:1634877_at:318:459; Interrogation_Position=734; Antisense; GATTGCAACTAACCCGAAGTCCCGG
>probe:Drosophila_2:1634877_at:565:197; Interrogation_Position=784; Antisense; AACGAGGAGGCTGCCGAGTACGCCT
>probe:Drosophila_2:1634877_at:191:91; Interrogation_Position=800; Antisense; AGTACGCCTACTACGATGATCGGGT
>probe:Drosophila_2:1634877_at:82:325; Interrogation_Position=848; Antisense; GCGAGGATCGTGAGGAGCCCACCTA
>probe:Drosophila_2:1634877_at:502:635; Interrogation_Position=879; Antisense; TCGCTACCGTCAGCAGCCAAATATG
>probe:Drosophila_2:1634877_at:544:359; Interrogation_Position=936; Antisense; GCAACATCAACGCTCTTTTATGGAA
>probe:Drosophila_2:1634877_at:621:389; Interrogation_Position=958; Antisense; GAAACTAGTCGGAGCAAGCCATTAA
>probe:Drosophila_2:1634877_at:171:655; Interrogation_Position=990; Antisense; TAATAATTATCAGGCCAACGGCAAT

Paste this into a BLAST search page for me
AAATGCCACAGACCCAATCCGGAGTTGGGTAACACACACACTATCGACGATGCCCCTGCCCAAAAGGATACTGAAAAACGTCACAGGATCAGGACCCGTAAGGACCCGTACGACCATCTGGAAAGAAGTCGAGTCCGAAGATTGCAACTAGATTGCAACTAACCCGAAGTCCCGGAACGAGGAGGCTGCCGAGTACGCCTAGTACGCCTACTACGATGATCGGGTGCGAGGATCGTGAGGAGCCCACCTATCGCTACCGTCAGCAGCCAAATATGGCAACATCAACGCTCTTTTATGGAAGAAACTAGTCGGAGCAAGCCATTAATAATAATTATCAGGCCAACGGCAAT

Full Affymetrix probeset data:

Annotations for 1634877_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720