FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634878_at:

>probe:Drosophila_2:1634878_at:573:485; Interrogation_Position=103; Antisense; GTAGAGGTGATAATGCCCTCGCCCG
>probe:Drosophila_2:1634878_at:397:605; Interrogation_Position=110; Antisense; TGATAATGCCCTCGCCCGTTTACAA
>probe:Drosophila_2:1634878_at:503:631; Interrogation_Position=121; Antisense; TCGCCCGTTTACAACCAGCCGGTGG
>probe:Drosophila_2:1634878_at:195:57; Interrogation_Position=13; Antisense; ATGTACAACGCAGGCTACCAGGTGG
>probe:Drosophila_2:1634878_at:648:729; Interrogation_Position=146; Antisense; TTGTGGTGGAGCAACCCAGCTACAA
>probe:Drosophila_2:1634878_at:692:357; Interrogation_Position=156; Antisense; GCAACCCAGCTACAATCAGCCAGGA
>probe:Drosophila_2:1634878_at:560:249; Interrogation_Position=187; Antisense; CAAGGACCCAGTGACGCCGAGTGCT
>probe:Drosophila_2:1634878_at:204:611; Interrogation_Position=198; Antisense; TGACGCCGAGTGCTGCATGCTGCTA
>probe:Drosophila_2:1634878_at:329:85; Interrogation_Position=206; Antisense; AGTGCTGCATGCTGCTAGGAGCCTG
>probe:Drosophila_2:1634878_at:429:619; Interrogation_Position=218; Antisense; TGCTAGGAGCCTGTTGTGTCATGGA
>probe:Drosophila_2:1634878_at:468:77; Interrogation_Position=242; Antisense; AGGAGTGTGGCCTGTGTGTCATCAT
>probe:Drosophila_2:1634878_at:455:517; Interrogation_Position=246; Antisense; GTGTGGCCTGTGTGTCATCATGTAG
>probe:Drosophila_2:1634878_at:251:673; Interrogation_Position=28; Antisense; TACCAGGTGGACGTGATCGATCCCT
>probe:Drosophila_2:1634878_at:264:557; Interrogation_Position=36; Antisense; GGACGTGATCGATCCCTACTATCAG

Paste this into a BLAST search page for me
GTAGAGGTGATAATGCCCTCGCCCGTGATAATGCCCTCGCCCGTTTACAATCGCCCGTTTACAACCAGCCGGTGGATGTACAACGCAGGCTACCAGGTGGTTGTGGTGGAGCAACCCAGCTACAAGCAACCCAGCTACAATCAGCCAGGACAAGGACCCAGTGACGCCGAGTGCTTGACGCCGAGTGCTGCATGCTGCTAAGTGCTGCATGCTGCTAGGAGCCTGTGCTAGGAGCCTGTTGTGTCATGGAAGGAGTGTGGCCTGTGTGTCATCATGTGTGGCCTGTGTGTCATCATGTAGTACCAGGTGGACGTGATCGATCCCTGGACGTGATCGATCCCTACTATCAG

Full Affymetrix probeset data:

Annotations for 1634878_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720