FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634879_at:

>probe:Drosophila_2:1634879_at:501:571; Interrogation_Position=169; Antisense; GGCGAACCGGTGCTCTTTGAAATAC
>probe:Drosophila_2:1634879_at:67:81; Interrogation_Position=19; Antisense; AGGGACCAGGCCAGGACGAACTTCA
>probe:Drosophila_2:1634879_at:498:397; Interrogation_Position=196; Antisense; GACACATGTCCCAAGGCTGAAGACG
>probe:Drosophila_2:1634879_at:593:103; Interrogation_Position=216; Antisense; AGACGAATACCCCAATGCAGCTGAG
>probe:Drosophila_2:1634879_at:13:55; Interrogation_Position=230; Antisense; ATGCAGCTGAGCTCGTTCAGTGGGC
>probe:Drosophila_2:1634879_at:700:439; Interrogation_Position=256; Antisense; GATGGCCTATTGCTGGTCTACTCGA
>probe:Drosophila_2:1634879_at:674:91; Interrogation_Position=295; Antisense; AGTTTCAACTATATACGCCGTGCCA
>probe:Drosophila_2:1634879_at:347:165; Interrogation_Position=319; Antisense; AAATCCGATCTTCAGTCCGATACAC
>probe:Drosophila_2:1634879_at:663:221; Interrogation_Position=365; Antisense; AAGTGGATATGGTGCACCTGCGCCA
>probe:Drosophila_2:1634879_at:311:431; Interrogation_Position=430; Antisense; GAGTGCAAGTTCAGCGAGGTCTCCG
>probe:Drosophila_2:1634879_at:77:523; Interrogation_Position=475; Antisense; GTGGCCGAGGTTTTCAACGAGCTGT
>probe:Drosophila_2:1634879_at:329:251; Interrogation_Position=519; Antisense; CAAGCGCAAGTCCAAGCAGAGTCTG
>probe:Drosophila_2:1634879_at:619:369; Interrogation_Position=70; Antisense; GAAGGACGACCCCTAATTGTGCGTT
>probe:Drosophila_2:1634879_at:459:507; Interrogation_Position=88; Antisense; GTGCGTTTCTTGACAAAGCGTTACA

Paste this into a BLAST search page for me
GGCGAACCGGTGCTCTTTGAAATACAGGGACCAGGCCAGGACGAACTTCAGACACATGTCCCAAGGCTGAAGACGAGACGAATACCCCAATGCAGCTGAGATGCAGCTGAGCTCGTTCAGTGGGCGATGGCCTATTGCTGGTCTACTCGAAGTTTCAACTATATACGCCGTGCCAAAATCCGATCTTCAGTCCGATACACAAGTGGATATGGTGCACCTGCGCCAGAGTGCAAGTTCAGCGAGGTCTCCGGTGGCCGAGGTTTTCAACGAGCTGTCAAGCGCAAGTCCAAGCAGAGTCTGGAAGGACGACCCCTAATTGTGCGTTGTGCGTTTCTTGACAAAGCGTTACA

Full Affymetrix probeset data:

Annotations for 1634879_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720