Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634880_s_at:

>probe:Drosophila_2:1634880_s_at:294:399; Interrogation_Position=494; Antisense; GACAGCGATTCCAGTTTTGGTCTAA
>probe:Drosophila_2:1634880_s_at:630:247; Interrogation_Position=518; Antisense; AATTGTGGCAAATCCTGTCGAGCTT
>probe:Drosophila_2:1634880_s_at:587:235; Interrogation_Position=528; Antisense; AATCCTGTCGAGCTTTTGCAGCCAT
>probe:Drosophila_2:1634880_s_at:260:269; Interrogation_Position=550; Antisense; CATGCCCTGTTGTAAGCGTACCGAG
>probe:Drosophila_2:1634880_s_at:698:719; Interrogation_Position=609; Antisense; TTGCCAGGCTCAACTGTACGCCGTG
>probe:Drosophila_2:1634880_s_at:503:329; Interrogation_Position=672; Antisense; GCGTGCTCTTCGTGCGCAACAAGGA
>probe:Drosophila_2:1634880_s_at:675:371; Interrogation_Position=739; Antisense; GAAGTAGGACTGACCGATCTGCCAT
>probe:Drosophila_2:1634880_s_at:590:269; Interrogation_Position=761; Antisense; CATGCCCGGCGGTAATATCAATCAT
>probe:Drosophila_2:1634880_s_at:177:23; Interrogation_Position=775; Antisense; ATATCAATCATCCAAGCCTGGCACT
>probe:Drosophila_2:1634880_s_at:422:313; Interrogation_Position=790; Antisense; GCCTGGCACTAGCTAATTGAACCTG
>probe:Drosophila_2:1634880_s_at:639:247; Interrogation_Position=804; Antisense; AATTGAACCTGGACTCATCATCACC
>probe:Drosophila_2:1634880_s_at:137:53; Interrogation_Position=830; Antisense; ATGAAGTTACCCAACCGTTTGCAGC
>probe:Drosophila_2:1634880_s_at:675:131; Interrogation_Position=843; Antisense; ACCGTTTGCAGCGTTAGCCAGGGAA
>probe:Drosophila_2:1634880_s_at:486:619; Interrogation_Position=875; Antisense; TGCCATTCGATAAGTTTGTCCGCCG

Paste this into a BLAST search page for me
GACAGCGATTCCAGTTTTGGTCTAAAATTGTGGCAAATCCTGTCGAGCTTAATCCTGTCGAGCTTTTGCAGCCATCATGCCCTGTTGTAAGCGTACCGAGTTGCCAGGCTCAACTGTACGCCGTGGCGTGCTCTTCGTGCGCAACAAGGAGAAGTAGGACTGACCGATCTGCCATCATGCCCGGCGGTAATATCAATCATATATCAATCATCCAAGCCTGGCACTGCCTGGCACTAGCTAATTGAACCTGAATTGAACCTGGACTCATCATCACCATGAAGTTACCCAACCGTTTGCAGCACCGTTTGCAGCGTTAGCCAGGGAATGCCATTCGATAAGTTTGTCCGCCG

Full Affymetrix probeset data:

Annotations for 1634880_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime