Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634881_at:

>probe:Drosophila_2:1634881_at:361:477; Interrogation_Position=2845; Antisense; GTTTTATCAACGACTCTCAACGGAG
>probe:Drosophila_2:1634881_at:480:513; Interrogation_Position=2882; Antisense; GTGTTCTACTATATGGAGGGCTCCA
>probe:Drosophila_2:1634881_at:392:571; Interrogation_Position=2900; Antisense; GGCTCCAAGGCCCAGTATCTAGCGG
>probe:Drosophila_2:1634881_at:696:479; Interrogation_Position=2914; Antisense; GTATCTAGCGGCCAAGGCCTTAAAA
>probe:Drosophila_2:1634881_at:607:183; Interrogation_Position=2937; Antisense; AAAAGCAGAGCTGGCGTTTCCACAC
>probe:Drosophila_2:1634881_at:111:575; Interrogation_Position=2949; Antisense; GGCGTTTCCACACAAAGTATATGAT
>probe:Drosophila_2:1634881_at:707:353; Interrogation_Position=2986; Antisense; GCACGAGGAGCCGAAGATTATCAAC
>probe:Drosophila_2:1634881_at:599:385; Interrogation_Position=3020; Antisense; GAACAGGGTACGTACATCTATTTTG
>probe:Drosophila_2:1634881_at:255:75; Interrogation_Position=3072; Antisense; AGGAGGGATTCACCTTTGAATACAA
>probe:Drosophila_2:1634881_at:355:183; Interrogation_Position=3124; Antisense; AAAATGTTGCGATGTTTGTTGCTTC
>probe:Drosophila_2:1634881_at:561:601; Interrogation_Position=3136; Antisense; TGTTTGTTGCTTCGTCTGTCTAAAA
>probe:Drosophila_2:1634881_at:199:347; Interrogation_Position=3341; Antisense; GCATGTTTTTTAGCTTTACTCCTTT
>probe:Drosophila_2:1634881_at:187:293; Interrogation_Position=3366; Antisense; CGTTAATTTTACATTCTTGCAGAAT
>probe:Drosophila_2:1634881_at:84:33; Interrogation_Position=3393; Antisense; ATAAGGATGCTTACTTTTATACACA

Paste this into a BLAST search page for me
GTTTTATCAACGACTCTCAACGGAGGTGTTCTACTATATGGAGGGCTCCAGGCTCCAAGGCCCAGTATCTAGCGGGTATCTAGCGGCCAAGGCCTTAAAAAAAAGCAGAGCTGGCGTTTCCACACGGCGTTTCCACACAAAGTATATGATGCACGAGGAGCCGAAGATTATCAACGAACAGGGTACGTACATCTATTTTGAGGAGGGATTCACCTTTGAATACAAAAAATGTTGCGATGTTTGTTGCTTCTGTTTGTTGCTTCGTCTGTCTAAAAGCATGTTTTTTAGCTTTACTCCTTTCGTTAATTTTACATTCTTGCAGAATATAAGGATGCTTACTTTTATACACA

Full Affymetrix probeset data:

Annotations for 1634881_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime