FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634882_at:

>probe:Drosophila_2:1634882_at:294:721; Interrogation_Position=104; Antisense; TTGATCCTCACTGCGGAATACTTCC
>probe:Drosophila_2:1634882_at:649:363; Interrogation_Position=119; Antisense; GAATACTTCCCGATTGTAACTTAGA
>probe:Drosophila_2:1634882_at:473:441; Interrogation_Position=142; Antisense; GATGGTCCAAATCCAAGTTACCTCA
>probe:Drosophila_2:1634882_at:663:473; Interrogation_Position=158; Antisense; GTTACCTCAAAAGGGTGTCGTGTGA
>probe:Drosophila_2:1634882_at:296:79; Interrogation_Position=204; Antisense; AGGATTCATCGAACTAATTCCCGGA
>probe:Drosophila_2:1634882_at:479:245; Interrogation_Position=219; Antisense; AATTCCCGGAAAATGTCTCCATGGT
>probe:Drosophila_2:1634882_at:294:61; Interrogation_Position=231; Antisense; ATGTCTCCATGGTAAACCGCGTTGC
>probe:Drosophila_2:1634882_at:480:657; Interrogation_Position=243; Antisense; TAAACCGCGTTGCTCGTTAAAATAG
>probe:Drosophila_2:1634882_at:594:117; Interrogation_Position=27; Antisense; AGCTATCATCGTTTTTATTCTGTTC
>probe:Drosophila_2:1634882_at:501:691; Interrogation_Position=271; Antisense; TATTGTTCCAATATTTCCATGCATA
>probe:Drosophila_2:1634882_at:108:691; Interrogation_Position=42; Antisense; TATTCTGTTCATTTCAAGTGTGCAT
>probe:Drosophila_2:1634882_at:653:711; Interrogation_Position=54; Antisense; TTCAAGTGTGCATGCTATGAGCAAA
>probe:Drosophila_2:1634882_at:46:57; Interrogation_Position=70; Antisense; ATGAGCAAATGCAACCAAGCAATTT
>probe:Drosophila_2:1634882_at:511:35; Interrogation_Position=95; Antisense; ATCTAAATCTTGATCCTCACTGCGG

Paste this into a BLAST search page for me
TTGATCCTCACTGCGGAATACTTCCGAATACTTCCCGATTGTAACTTAGAGATGGTCCAAATCCAAGTTACCTCAGTTACCTCAAAAGGGTGTCGTGTGAAGGATTCATCGAACTAATTCCCGGAAATTCCCGGAAAATGTCTCCATGGTATGTCTCCATGGTAAACCGCGTTGCTAAACCGCGTTGCTCGTTAAAATAGAGCTATCATCGTTTTTATTCTGTTCTATTGTTCCAATATTTCCATGCATATATTCTGTTCATTTCAAGTGTGCATTTCAAGTGTGCATGCTATGAGCAAAATGAGCAAATGCAACCAAGCAATTTATCTAAATCTTGATCCTCACTGCGG

Full Affymetrix probeset data:

Annotations for 1634882_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720