FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634883_at:

>probe:Drosophila_2:1634883_at:161:253; Interrogation_Position=342; Antisense; CAAGACTCAGAAACGGGCGCCTGTA
>probe:Drosophila_2:1634883_at:323:53; Interrogation_Position=385; Antisense; ATGCTCACCGACATGGTCAAGGGAA
>probe:Drosophila_2:1634883_at:172:191; Interrogation_Position=409; Antisense; AACTTTATTAACGTGCTGCCCATGG
>probe:Drosophila_2:1634883_at:11:283; Interrogation_Position=424; Antisense; CTGCCCATGGTCGTGATCGGTGGCT
>probe:Drosophila_2:1634883_at:619:41; Interrogation_Position=439; Antisense; ATCGGTGGCTGGATCAACTGGATGT
>probe:Drosophila_2:1634883_at:524:193; Interrogation_Position=454; Antisense; AACTGGATGTTTTCGGGCTTCGTCA
>probe:Drosophila_2:1634883_at:595:453; Interrogation_Position=498; Antisense; GTTGACCCTGCGCTTTAAGCCCATG
>probe:Drosophila_2:1634883_at:477:677; Interrogation_Position=579; Antisense; TTGGTACTTCCTCAACGTGTTCGGC
>probe:Drosophila_2:1634883_at:212:39; Interrogation_Position=613; Antisense; ATCTACACACTGGTTCTTGGCGAGA
>probe:Drosophila_2:1634883_at:514:423; Interrogation_Position=634; Antisense; GAGAACAATCATGCCGATCAGACGC
>probe:Drosophila_2:1634883_at:557:51; Interrogation_Position=691; Antisense; ATGACTATGCCCCAGGATCCAAAGG
>probe:Drosophila_2:1634883_at:515:487; Interrogation_Position=756; Antisense; GTACCACAACGCACTCAAGAACATT
>probe:Drosophila_2:1634883_at:226:191; Interrogation_Position=775; Antisense; AACATTGACGCTGACATGCTGGCTA
>probe:Drosophila_2:1634883_at:381:303; Interrogation_Position=812; Antisense; CCGCGGCATCATCCTAATTAAGTTA

Paste this into a BLAST search page for me
CAAGACTCAGAAACGGGCGCCTGTAATGCTCACCGACATGGTCAAGGGAAAACTTTATTAACGTGCTGCCCATGGCTGCCCATGGTCGTGATCGGTGGCTATCGGTGGCTGGATCAACTGGATGTAACTGGATGTTTTCGGGCTTCGTCAGTTGACCCTGCGCTTTAAGCCCATGTTGGTACTTCCTCAACGTGTTCGGCATCTACACACTGGTTCTTGGCGAGAGAGAACAATCATGCCGATCAGACGCATGACTATGCCCCAGGATCCAAAGGGTACCACAACGCACTCAAGAACATTAACATTGACGCTGACATGCTGGCTACCGCGGCATCATCCTAATTAAGTTA

Full Affymetrix probeset data:

Annotations for 1634883_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720