FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634885_at:

>probe:Drosophila_2:1634885_at:232:27; Interrogation_Position=1012; Antisense; ATAGCTCTGGAGATCACTCTGTACA
>probe:Drosophila_2:1634885_at:585:383; Interrogation_Position=1069; Antisense; GAACTGCTGTTCCATGACTGGTACA
>probe:Drosophila_2:1634885_at:651:183; Interrogation_Position=1138; Antisense; AAAATGATGCTGCTTTTCTCACGCC
>probe:Drosophila_2:1634885_at:250:641; Interrogation_Position=1154; Antisense; TCTCACGCCGAACTTTTGTTTTAAG
>probe:Drosophila_2:1634885_at:392:329; Interrogation_Position=1178; Antisense; GCGTGGGTGGGTTTACAAGTCTCTC
>probe:Drosophila_2:1634885_at:177:217; Interrogation_Position=1207; Antisense; AAGTTCCTAGTGCAGGTCTTTCGGT
>probe:Drosophila_2:1634885_at:126:607; Interrogation_Position=1232; Antisense; TGAGTGCAAACTTCTTTCTGCTCCT
>probe:Drosophila_2:1634885_at:362:341; Interrogation_Position=698; Antisense; GCTTTAACAGCCTTTTCGTGGTCCT
>probe:Drosophila_2:1634885_at:121:591; Interrogation_Position=764; Antisense; TGGTCCAAAATTCCACCTCGGATAT
>probe:Drosophila_2:1634885_at:523:455; Interrogation_Position=784; Antisense; GATATCCTGGTTCCCAAGGACCAAA
>probe:Drosophila_2:1634885_at:504:511; Interrogation_Position=832; Antisense; GTGAGGCTTTTTGCTCGCATATCAA
>probe:Drosophila_2:1634885_at:307:47; Interrogation_Position=895; Antisense; ATCCTGGTTCAGTGTTCCGTTAGCA
>probe:Drosophila_2:1634885_at:12:693; Interrogation_Position=924; Antisense; TTTGATCTGCATGCTGCTCTACAAG
>probe:Drosophila_2:1634885_at:519:497; Interrogation_Position=997; Antisense; GTCTACTTTGTGACCATAGCTCTGG

Paste this into a BLAST search page for me
ATAGCTCTGGAGATCACTCTGTACAGAACTGCTGTTCCATGACTGGTACAAAAATGATGCTGCTTTTCTCACGCCTCTCACGCCGAACTTTTGTTTTAAGGCGTGGGTGGGTTTACAAGTCTCTCAAGTTCCTAGTGCAGGTCTTTCGGTTGAGTGCAAACTTCTTTCTGCTCCTGCTTTAACAGCCTTTTCGTGGTCCTTGGTCCAAAATTCCACCTCGGATATGATATCCTGGTTCCCAAGGACCAAAGTGAGGCTTTTTGCTCGCATATCAAATCCTGGTTCAGTGTTCCGTTAGCATTTGATCTGCATGCTGCTCTACAAGGTCTACTTTGTGACCATAGCTCTGG

Full Affymetrix probeset data:

Annotations for 1634885_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720