Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634888_at:

>probe:Drosophila_2:1634888_at:432:501; Interrogation_Position=104; Antisense; GTCCGCATTACGAAATCGCTGAGGT
>probe:Drosophila_2:1634888_at:83:393; Interrogation_Position=130; Antisense; GAAATGCTCCAGTTTTGGGTAATTC
>probe:Drosophila_2:1634888_at:241:701; Interrogation_Position=152; Antisense; TTCATTTGGTCACACCAGGTGGCCA
>probe:Drosophila_2:1634888_at:699:157; Interrogation_Position=176; Antisense; ACACGGCCAACGTCTCAAAGGAGCA
>probe:Drosophila_2:1634888_at:656:267; Interrogation_Position=213; Antisense; CATGGACTTGTACTTGGAATTGGAA
>probe:Drosophila_2:1634888_at:356:27; Interrogation_Position=262; Antisense; ATAGCCTGCGGCTCTGAATTCCTGA
>probe:Drosophila_2:1634888_at:494:509; Interrogation_Position=41; Antisense; GTGAAGTTGTCGAAATGGGCGCCAA
>probe:Drosophila_2:1634888_at:680:613; Interrogation_Position=422; Antisense; TGAAGTGTGCGCATCATTCGGCCGA
>probe:Drosophila_2:1634888_at:251:273; Interrogation_Position=436; Antisense; CATTCGGCCGAATTTGTCACGATTA
>probe:Drosophila_2:1634888_at:301:135; Interrogation_Position=466; Antisense; ACGCGATACTCGTATTCACATCACT
>probe:Drosophila_2:1634888_at:412:481; Interrogation_Position=477; Antisense; GTATTCACATCACTTTAGGCCGACT
>probe:Drosophila_2:1634888_at:342:595; Interrogation_Position=56; Antisense; TGGGCGCCAAATCCTGTACAGAGCA
>probe:Drosophila_2:1634888_at:545:99; Interrogation_Position=75; Antisense; AGAGCACCAGTTCCCACAGGATTTG
>probe:Drosophila_2:1634888_at:249:151; Interrogation_Position=90; Antisense; ACAGGATTTGGCCAGTCCGCATTAC

Paste this into a BLAST search page for me
GTCCGCATTACGAAATCGCTGAGGTGAAATGCTCCAGTTTTGGGTAATTCTTCATTTGGTCACACCAGGTGGCCAACACGGCCAACGTCTCAAAGGAGCACATGGACTTGTACTTGGAATTGGAAATAGCCTGCGGCTCTGAATTCCTGAGTGAAGTTGTCGAAATGGGCGCCAATGAAGTGTGCGCATCATTCGGCCGACATTCGGCCGAATTTGTCACGATTAACGCGATACTCGTATTCACATCACTGTATTCACATCACTTTAGGCCGACTTGGGCGCCAAATCCTGTACAGAGCAAGAGCACCAGTTCCCACAGGATTTGACAGGATTTGGCCAGTCCGCATTAC

Full Affymetrix probeset data:

Annotations for 1634888_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime