FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634889_at:

>probe:Drosophila_2:1634889_at:712:619; Interrogation_Position=1094; Antisense; TGCTCACGGTGGCTTTGATCAGCTC
>probe:Drosophila_2:1634889_at:14:653; Interrogation_Position=1125; Antisense; TCAACGCTGTGCATCTCGTCTGGAG
>probe:Drosophila_2:1634889_at:385:31; Interrogation_Position=1198; Antisense; ATGAACCCAATACTGTACGCCTTTT
>probe:Drosophila_2:1634889_at:602:419; Interrogation_Position=1242; Antisense; GAGCTTCATGAAGGCCTGCACGTGT
>probe:Drosophila_2:1634889_at:327:617; Interrogation_Position=1258; Antisense; TGCACGTGTGCTGCCCGCAAGGATG
>probe:Drosophila_2:1634889_at:246:587; Interrogation_Position=1301; Antisense; TGGAGAACAGTTTCTTCCCCAAGTT
>probe:Drosophila_2:1634889_at:198:223; Interrogation_Position=1330; Antisense; AAGGGCAGGCAATCGGAGCGTCTTC
>probe:Drosophila_2:1634889_at:616:417; Interrogation_Position=1345; Antisense; GAGCGTCTTCTTGGTGGCAATGGAA
>probe:Drosophila_2:1634889_at:688:179; Interrogation_Position=1422; Antisense; AAACAACAATGCTCCGATGGCCACT
>probe:Drosophila_2:1634889_at:22:441; Interrogation_Position=1437; Antisense; GATGGCCACTACAACGACGACGACA
>probe:Drosophila_2:1634889_at:217:197; Interrogation_Position=1470; Antisense; AACGGGCACGGATGCAGTGACCTGT
>probe:Drosophila_2:1634889_at:300:89; Interrogation_Position=1506; Antisense; AGTACACCAGGTGCCAGCCGAGATC
>probe:Drosophila_2:1634889_at:322:261; Interrogation_Position=1548; Antisense; CACCGTGCTGGTGGTCAATGCTGAG
>probe:Drosophila_2:1634889_at:668:375; Interrogation_Position=1570; Antisense; GAGACCAACAACTGTAAACCGCCCG

Paste this into a BLAST search page for me
TGCTCACGGTGGCTTTGATCAGCTCTCAACGCTGTGCATCTCGTCTGGAGATGAACCCAATACTGTACGCCTTTTGAGCTTCATGAAGGCCTGCACGTGTTGCACGTGTGCTGCCCGCAAGGATGTGGAGAACAGTTTCTTCCCCAAGTTAAGGGCAGGCAATCGGAGCGTCTTCGAGCGTCTTCTTGGTGGCAATGGAAAAACAACAATGCTCCGATGGCCACTGATGGCCACTACAACGACGACGACAAACGGGCACGGATGCAGTGACCTGTAGTACACCAGGTGCCAGCCGAGATCCACCGTGCTGGTGGTCAATGCTGAGGAGACCAACAACTGTAAACCGCCCG

Full Affymetrix probeset data:

Annotations for 1634889_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720