FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634890_at:

>probe:Drosophila_2:1634890_at:503:83; Interrogation_Position=105; Antisense; AGTGGCTCCCTACAACCAGGCTGTG
>probe:Drosophila_2:1634890_at:679:449; Interrogation_Position=136; Antisense; GATCGTACTGTGTATGTGTCCGGAT
>probe:Drosophila_2:1634890_at:257:499; Interrogation_Position=161; Antisense; GTCTGGGTCTGGACAAGGACACCAT
>probe:Drosophila_2:1634890_at:456:207; Interrogation_Position=186; Antisense; GAAACTGGTTCCTGGAGGACCCACT
>probe:Drosophila_2:1634890_at:291:437; Interrogation_Position=200; Antisense; GAGGACCCACTGAACAAGCGCAGAA
>probe:Drosophila_2:1634890_at:506:439; Interrogation_Position=241; Antisense; GAGGCTGTTCTAAAGGCGGCCGATT
>probe:Drosophila_2:1634890_at:534:187; Interrogation_Position=289; Antisense; AACACAGTGTTCTTGAAGGATCTCA
>probe:Drosophila_2:1634890_at:58:495; Interrogation_Position=328; Antisense; GTCAATGAGGTCTACAAGCGGGTGT
>probe:Drosophila_2:1634890_at:606:599; Interrogation_Position=350; Antisense; TGTTCAATAAGGATTTCCCGGCCCG
>probe:Drosophila_2:1634890_at:572:303; Interrogation_Position=372; Antisense; CCGCAGCTGTTTCCAGGTGGCCAAG
>probe:Drosophila_2:1634890_at:380:207; Interrogation_Position=394; Antisense; AAGCTGCCCATGGATGCTCTGGTGG
>probe:Drosophila_2:1634890_at:72:97; Interrogation_Position=419; Antisense; AGATCGAGTGCATTGCCTTGACCGG
>probe:Drosophila_2:1634890_at:597:315; Interrogation_Position=433; Antisense; GCCTTGACCGGATCTGTGGAGACGA
>probe:Drosophila_2:1634890_at:587:355; Interrogation_Position=83; Antisense; GCACTGCAAATGCTGCCAAGCCAGT

Paste this into a BLAST search page for me
AGTGGCTCCCTACAACCAGGCTGTGGATCGTACTGTGTATGTGTCCGGATGTCTGGGTCTGGACAAGGACACCATGAAACTGGTTCCTGGAGGACCCACTGAGGACCCACTGAACAAGCGCAGAAGAGGCTGTTCTAAAGGCGGCCGATTAACACAGTGTTCTTGAAGGATCTCAGTCAATGAGGTCTACAAGCGGGTGTTGTTCAATAAGGATTTCCCGGCCCGCCGCAGCTGTTTCCAGGTGGCCAAGAAGCTGCCCATGGATGCTCTGGTGGAGATCGAGTGCATTGCCTTGACCGGGCCTTGACCGGATCTGTGGAGACGAGCACTGCAAATGCTGCCAAGCCAGT

Full Affymetrix probeset data:

Annotations for 1634890_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720