FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634891_at:

>probe:Drosophila_2:1634891_at:676:323; Interrogation_Position=5528; Antisense; GCGACATTCTACATGCGGCAGAGGC
>probe:Drosophila_2:1634891_at:257:27; Interrogation_Position=5553; Antisense; ATACCTACAGGAGCGCGATCTGCAG
>probe:Drosophila_2:1634891_at:157:583; Interrogation_Position=5616; Antisense; TGGCGATGTGTCAACAGCCGATCTG
>probe:Drosophila_2:1634891_at:378:565; Interrogation_Position=5706; Antisense; GGAATTCGTGAACGCAGCCAACGCT
>probe:Drosophila_2:1634891_at:222:201; Interrogation_Position=5725; Antisense; AACGCTGGCGTTGGAATGCTTCACA
>probe:Drosophila_2:1634891_at:555:231; Interrogation_Position=5739; Antisense; AATGCTTCACATCGATACTCGCAAC
>probe:Drosophila_2:1634891_at:256:197; Interrogation_Position=5761; Antisense; AACGGCCCTGGTCTACTGCATGTGG
>probe:Drosophila_2:1634891_at:62:123; Interrogation_Position=5803; Antisense; AGCGTGGTGTTCATTTCGCATCCGA
>probe:Drosophila_2:1634891_at:323:47; Interrogation_Position=5822; Antisense; ATCCGATGCCTACGCAGAATGTCCA
>probe:Drosophila_2:1634891_at:13:425; Interrogation_Position=5878; Antisense; GAGACAAACGCGCTGCTCGACCAGA
>probe:Drosophila_2:1634891_at:592:201; Interrogation_Position=5974; Antisense; AACCTGGAGGATAGTCTGGCCGTGA
>probe:Drosophila_2:1634891_at:174:491; Interrogation_Position=6004; Antisense; GTGACGAACGGCAGTGGCGTACCCA
>probe:Drosophila_2:1634891_at:544:585; Interrogation_Position=6035; Antisense; TGGAACTGCCCATTACCGTGACCAA
>probe:Drosophila_2:1634891_at:493:333; Interrogation_Position=6102; Antisense; GCTGCAGTTTGCTCCTTTTCAGTAG

Paste this into a BLAST search page for me
GCGACATTCTACATGCGGCAGAGGCATACCTACAGGAGCGCGATCTGCAGTGGCGATGTGTCAACAGCCGATCTGGGAATTCGTGAACGCAGCCAACGCTAACGCTGGCGTTGGAATGCTTCACAAATGCTTCACATCGATACTCGCAACAACGGCCCTGGTCTACTGCATGTGGAGCGTGGTGTTCATTTCGCATCCGAATCCGATGCCTACGCAGAATGTCCAGAGACAAACGCGCTGCTCGACCAGAAACCTGGAGGATAGTCTGGCCGTGAGTGACGAACGGCAGTGGCGTACCCATGGAACTGCCCATTACCGTGACCAAGCTGCAGTTTGCTCCTTTTCAGTAG

Full Affymetrix probeset data:

Annotations for 1634891_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720