FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634892_at:

>probe:Drosophila_2:1634892_at:83:531; Interrogation_Position=2872; Antisense; GGGATTCTAAGAGCTCACCACCAAG
>probe:Drosophila_2:1634892_at:404:547; Interrogation_Position=2898; Antisense; GGATGCGAACGCCATTGAACCCCTA
>probe:Drosophila_2:1634892_at:619:33; Interrogation_Position=2935; Antisense; ATCAAGAGCGCGTTGCTTCGGGAAA
>probe:Drosophila_2:1634892_at:231:463; Interrogation_Position=3013; Antisense; GATTCTCCTGAAGTGGATAGCCTTA
>probe:Drosophila_2:1634892_at:369:541; Interrogation_Position=3027; Antisense; GGATAGCCTTAAGCCGCAAACGGGA
>probe:Drosophila_2:1634892_at:579:71; Interrogation_Position=3083; Antisense; AGGAATCATTTCTCTCGCTAAACGG
>probe:Drosophila_2:1634892_at:119:141; Interrogation_Position=3104; Antisense; ACGGAATCCTTCAAAGGCTCTCCCT
>probe:Drosophila_2:1634892_at:162:641; Interrogation_Position=3122; Antisense; TCTCCCTCGACACGGATAAGGTGCA
>probe:Drosophila_2:1634892_at:351:195; Interrogation_Position=3170; Antisense; AACTGGTCCAAAGAGTAGCCCCATC
>probe:Drosophila_2:1634892_at:377:225; Interrogation_Position=3217; Antisense; AAGGAGATCCTCAAGCGCAACGCAC
>probe:Drosophila_2:1634892_at:578:323; Interrogation_Position=3231; Antisense; GCGCAACGCACAGAAGCTCAAGGGC
>probe:Drosophila_2:1634892_at:14:221; Interrogation_Position=3250; Antisense; AAGGGCGCATTCAACTAGAGACACT
>probe:Drosophila_2:1634892_at:47:313; Interrogation_Position=3298; Antisense; GCCAAATTGCTAAATCCCGGCGATT
>probe:Drosophila_2:1634892_at:704:15; Interrogation_Position=3416; Antisense; ATTATTGTCCATACCATGTGCGCCA

Paste this into a BLAST search page for me
GGGATTCTAAGAGCTCACCACCAAGGGATGCGAACGCCATTGAACCCCTAATCAAGAGCGCGTTGCTTCGGGAAAGATTCTCCTGAAGTGGATAGCCTTAGGATAGCCTTAAGCCGCAAACGGGAAGGAATCATTTCTCTCGCTAAACGGACGGAATCCTTCAAAGGCTCTCCCTTCTCCCTCGACACGGATAAGGTGCAAACTGGTCCAAAGAGTAGCCCCATCAAGGAGATCCTCAAGCGCAACGCACGCGCAACGCACAGAAGCTCAAGGGCAAGGGCGCATTCAACTAGAGACACTGCCAAATTGCTAAATCCCGGCGATTATTATTGTCCATACCATGTGCGCCA

Full Affymetrix probeset data:

Annotations for 1634892_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720