FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634893_at:

>probe:Drosophila_2:1634893_at:484:461; Interrogation_Position=1597; Antisense; GATTCCATTTTCTAACCAGTTAACT
>probe:Drosophila_2:1634893_at:397:77; Interrogation_Position=1635; Antisense; AGGTTGTTGCCTTAGTTAGCTTATT
>probe:Drosophila_2:1634893_at:571:653; Interrogation_Position=1665; Antisense; TAATCCAAAACCACGCATATCCAAC
>probe:Drosophila_2:1634893_at:481:345; Interrogation_Position=1679; Antisense; GCATATCCAACGAACCACGGAAGAA
>probe:Drosophila_2:1634893_at:404:195; Interrogation_Position=1704; Antisense; AACTGACAACCAAAGTCTGCTTTAA
>probe:Drosophila_2:1634893_at:106:467; Interrogation_Position=1741; Antisense; GTTGTTTTCAATTCCAAACTAGCCA
>probe:Drosophila_2:1634893_at:224:703; Interrogation_Position=1802; Antisense; TTTTGTGGCCACAAGTAGCCGACGG
>probe:Drosophila_2:1634893_at:86:419; Interrogation_Position=1826; Antisense; GAGCTGGCGAGAGGATCTTAGTATA
>probe:Drosophila_2:1634893_at:460:655; Interrogation_Position=1855; Antisense; TAATCGGACTGCGTAGACACTAGAA
>probe:Drosophila_2:1634893_at:359:227; Interrogation_Position=1883; Antisense; AATGATTACCCAAAGGTCGTTGCAA
>probe:Drosophila_2:1634893_at:583:479; Interrogation_Position=1936; Antisense; GTTTGTTTATTTTCTATCACCTAAT
>probe:Drosophila_2:1634893_at:338:45; Interrogation_Position=2028; Antisense; ATCCTTACATAGATGGCGCTAGGTA
>probe:Drosophila_2:1634893_at:64:217; Interrogation_Position=2053; Antisense; AAGTTTCTACATGCGCGCCTTTAAG
>probe:Drosophila_2:1634893_at:171:33; Interrogation_Position=2151; Antisense; ATAATCATGTATTTAACCCTTTGTC

Paste this into a BLAST search page for me
GATTCCATTTTCTAACCAGTTAACTAGGTTGTTGCCTTAGTTAGCTTATTTAATCCAAAACCACGCATATCCAACGCATATCCAACGAACCACGGAAGAAAACTGACAACCAAAGTCTGCTTTAAGTTGTTTTCAATTCCAAACTAGCCATTTTGTGGCCACAAGTAGCCGACGGGAGCTGGCGAGAGGATCTTAGTATATAATCGGACTGCGTAGACACTAGAAAATGATTACCCAAAGGTCGTTGCAAGTTTGTTTATTTTCTATCACCTAATATCCTTACATAGATGGCGCTAGGTAAAGTTTCTACATGCGCGCCTTTAAGATAATCATGTATTTAACCCTTTGTC

Full Affymetrix probeset data:

Annotations for 1634893_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720