FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634894_at:

>probe:Drosophila_2:1634894_at:659:99; Interrogation_Position=104; Antisense; AGAGGCGCTCGCAAGGTTCGGAATC
>probe:Drosophila_2:1634894_at:371:551; Interrogation_Position=208; Antisense; GGAGAACCATCGCTCAATATCGGAA
>probe:Drosophila_2:1634894_at:707:449; Interrogation_Position=234; Antisense; GATCGATTTATCCTTTCCCGAAACA
>probe:Drosophila_2:1634894_at:319:427; Interrogation_Position=265; Antisense; GAGTTCGAAAACAGTCCCCAGTGCT
>probe:Drosophila_2:1634894_at:103:87; Interrogation_Position=284; Antisense; AGTGCTATCCTCCATCGTACTATAC
>probe:Drosophila_2:1634894_at:573:541; Interrogation_Position=326; Antisense; GGTTGCTCCTGCTGTACGCTGAGAA
>probe:Drosophila_2:1634894_at:564:375; Interrogation_Position=357; Antisense; GAAGCAATTGGTTCTCAGCTACCCA
>probe:Drosophila_2:1634894_at:43:215; Interrogation_Position=382; Antisense; AAGAGACGAGCCATGGTCTTGGCCC
>probe:Drosophila_2:1634894_at:604:575; Interrogation_Position=402; Antisense; GGCCCTGCCCAACGAATGCAAAGTA
>probe:Drosophila_2:1634894_at:572:267; Interrogation_Position=427; Antisense; CAGGTGAAGTCAGCACCATCTGCTC
>probe:Drosophila_2:1634894_at:549:37; Interrogation_Position=444; Antisense; ATCTGCTCCTTTAGTGGCCAGCGTT
>probe:Drosophila_2:1634894_at:177:519; Interrogation_Position=46; Antisense; GTGGTGAGCAACATCGACCCGAGTC
>probe:Drosophila_2:1634894_at:622:307; Interrogation_Position=460; Antisense; GCCAGCGTTTTGATAAATTGCCACT
>probe:Drosophila_2:1634894_at:437:633; Interrogation_Position=69; Antisense; TCGCTATAGCGCCAAGTTCAAGGAA

Paste this into a BLAST search page for me
AGAGGCGCTCGCAAGGTTCGGAATCGGAGAACCATCGCTCAATATCGGAAGATCGATTTATCCTTTCCCGAAACAGAGTTCGAAAACAGTCCCCAGTGCTAGTGCTATCCTCCATCGTACTATACGGTTGCTCCTGCTGTACGCTGAGAAGAAGCAATTGGTTCTCAGCTACCCAAAGAGACGAGCCATGGTCTTGGCCCGGCCCTGCCCAACGAATGCAAAGTACAGGTGAAGTCAGCACCATCTGCTCATCTGCTCCTTTAGTGGCCAGCGTTGTGGTGAGCAACATCGACCCGAGTCGCCAGCGTTTTGATAAATTGCCACTTCGCTATAGCGCCAAGTTCAAGGAA

Full Affymetrix probeset data:

Annotations for 1634894_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720