FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634896_at:

>probe:Drosophila_2:1634896_at:163:41; Interrogation_Position=13; Antisense; ATCGATCCAGAACGTACCATGGGTA
>probe:Drosophila_2:1634896_at:665:419; Interrogation_Position=130; Antisense; GAGCAGTTGTGCCAGATAAACATAA
>probe:Drosophila_2:1634896_at:665:505; Interrogation_Position=138; Antisense; GTGCCAGATAAACATAAAACATTTT
>probe:Drosophila_2:1634896_at:8:295; Interrogation_Position=15; Antisense; CGATCCAGAACGTACCATGGGTAAC
>probe:Drosophila_2:1634896_at:412:457; Interrogation_Position=168; Antisense; GATAGTTTTTCCAAAGAAATGTGTG
>probe:Drosophila_2:1634896_at:601:627; Interrogation_Position=18; Antisense; TCCAGAACGTACCATGGGTAACGAT
>probe:Drosophila_2:1634896_at:285:393; Interrogation_Position=183; Antisense; GAAATGTGTGAATCATTGTTTCAAA
>probe:Drosophila_2:1634896_at:157:239; Interrogation_Position=193; Antisense; AATCATTGTTTCAAAATGCGATACA
>probe:Drosophila_2:1634896_at:58:487; Interrogation_Position=26; Antisense; GTACCATGGGTAACGATATACGAAG
>probe:Drosophila_2:1634896_at:467:537; Interrogation_Position=34; Antisense; GGTAACGATATACGAAGCGATGCTT
>probe:Drosophila_2:1634896_at:35:199; Interrogation_Position=37; Antisense; AACGATATACGAAGCGATGCTTGGT
>probe:Drosophila_2:1634896_at:435:727; Interrogation_Position=64; Antisense; TTGGGCATCACTTTGATGGAGGTAG
>probe:Drosophila_2:1634896_at:65:35; Interrogation_Position=70; Antisense; ATCACTTTGATGGAGGTAGCGACTG
>probe:Drosophila_2:1634896_at:623:277; Interrogation_Position=74; Antisense; CTTTGATGGAGGTAGCGACTGGTAA

Paste this into a BLAST search page for me
ATCGATCCAGAACGTACCATGGGTAGAGCAGTTGTGCCAGATAAACATAAGTGCCAGATAAACATAAAACATTTTCGATCCAGAACGTACCATGGGTAACGATAGTTTTTCCAAAGAAATGTGTGTCCAGAACGTACCATGGGTAACGATGAAATGTGTGAATCATTGTTTCAAAAATCATTGTTTCAAAATGCGATACAGTACCATGGGTAACGATATACGAAGGGTAACGATATACGAAGCGATGCTTAACGATATACGAAGCGATGCTTGGTTTGGGCATCACTTTGATGGAGGTAGATCACTTTGATGGAGGTAGCGACTGCTTTGATGGAGGTAGCGACTGGTAA

Full Affymetrix probeset data:

Annotations for 1634896_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720