Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634898_a_at:

>probe:Drosophila_2:1634898_a_at:76:317; Interrogation_Position=329; Antisense; GCCTCGATCTTCAAGCAACCGGTGA
>probe:Drosophila_2:1634898_a_at:712:195; Interrogation_Position=345; Antisense; AACCGGTGACGGTGATTCGCAACCA
>probe:Drosophila_2:1634898_a_at:724:269; Interrogation_Position=368; Antisense; CATAAACAGGATCCCGCCAAAGCGA
>probe:Drosophila_2:1634898_a_at:619:367; Interrogation_Position=394; Antisense; GAATGAACCCAAGCATGGCACTCGG
>probe:Drosophila_2:1634898_a_at:656:203; Interrogation_Position=422; Antisense; AAGCCGAAACAGCTGTTCTGGGAGA
>probe:Drosophila_2:1634898_a_at:563:437; Interrogation_Position=485; Antisense; GAGGAGCTAGACGACATCTCACTGC
>probe:Drosophila_2:1634898_a_at:80:467; Interrogation_Position=527; Antisense; GTTGGCCCCAATGTCAACGAACAGA
>probe:Drosophila_2:1634898_a_at:533:487; Interrogation_Position=599; Antisense; GTACACGGCCAGAGTTCTACGAAGG
>probe:Drosophila_2:1634898_a_at:168:369; Interrogation_Position=637; Antisense; GAATGCCATGGCGTTTATGAATCCT
>probe:Drosophila_2:1634898_a_at:569:367; Interrogation_Position=655; Antisense; GAATCCTGAACAACCGCTAATGCAC
>probe:Drosophila_2:1634898_a_at:563:53; Interrogation_Position=674; Antisense; ATGCACGCGGTGATCATTTCGGAGG
>probe:Drosophila_2:1634898_a_at:405:307; Interrogation_Position=786; Antisense; CCATGCATCTACCAATTCCATTGTA
>probe:Drosophila_2:1634898_a_at:306:485; Interrogation_Position=808; Antisense; GTAGGCTCTAACATCTCTATCGTAT
>probe:Drosophila_2:1634898_a_at:239:275; Interrogation_Position=828; Antisense; CGTATTGACCCCTATTCGAAATCTA

Paste this into a BLAST search page for me
GCCTCGATCTTCAAGCAACCGGTGAAACCGGTGACGGTGATTCGCAACCACATAAACAGGATCCCGCCAAAGCGAGAATGAACCCAAGCATGGCACTCGGAAGCCGAAACAGCTGTTCTGGGAGAGAGGAGCTAGACGACATCTCACTGCGTTGGCCCCAATGTCAACGAACAGAGTACACGGCCAGAGTTCTACGAAGGGAATGCCATGGCGTTTATGAATCCTGAATCCTGAACAACCGCTAATGCACATGCACGCGGTGATCATTTCGGAGGCCATGCATCTACCAATTCCATTGTAGTAGGCTCTAACATCTCTATCGTATCGTATTGACCCCTATTCGAAATCTA

Full Affymetrix probeset data:

Annotations for 1634898_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime