FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634900_at:

>probe:Drosophila_2:1634900_at:340:429; Interrogation_Position=133; Antisense; GAGTTCTTGGCAAGGCCTTCTTATA
>probe:Drosophila_2:1634900_at:237:87; Interrogation_Position=190; Antisense; AGTCCAGTGCGTTGAGCCTACTGCA
>probe:Drosophila_2:1634900_at:579:125; Interrogation_Position=204; Antisense; AGCCTACTGCACTGTCACTATTTAG
>probe:Drosophila_2:1634900_at:642:147; Interrogation_Position=220; Antisense; ACTATTTAGGCGTCTGTCCAATCTG
>probe:Drosophila_2:1634900_at:71:625; Interrogation_Position=243; Antisense; TGCGCTCTGAGCTCATTTTCAGGAA
>probe:Drosophila_2:1634900_at:574:399; Interrogation_Position=272; Antisense; GACATCATGTTCGAGTCCGTGTTCT
>probe:Drosophila_2:1634900_at:192:293; Interrogation_Position=298; Antisense; CGTACTGCGGCAATTCTACAACTTT
>probe:Drosophila_2:1634900_at:196:631; Interrogation_Position=32; Antisense; TCGGTCCTCCGTTTGAAATTCAACT
>probe:Drosophila_2:1634900_at:63:499; Interrogation_Position=323; Antisense; GTCTGCCCCATGCAAATTTTCTATG
>probe:Drosophila_2:1634900_at:266:385; Interrogation_Position=401; Antisense; GAACTTTGAGATTTGACGGCATGAC
>probe:Drosophila_2:1634900_at:27:665; Interrogation_Position=473; Antisense; TAAAGAGATCTCTCGCTTTTCCTCT
>probe:Drosophila_2:1634900_at:411:715; Interrogation_Position=491; Antisense; TTCCTCTTAAGTCACCCAGGTAACA
>probe:Drosophila_2:1634900_at:322:145; Interrogation_Position=518; Antisense; ACTCCGATTCGCACATAATTTTCGC
>probe:Drosophila_2:1634900_at:368:59; Interrogation_Position=555; Antisense; ATGTTTAAAGCCTTGCCACTGAGCA

Paste this into a BLAST search page for me
GAGTTCTTGGCAAGGCCTTCTTATAAGTCCAGTGCGTTGAGCCTACTGCAAGCCTACTGCACTGTCACTATTTAGACTATTTAGGCGTCTGTCCAATCTGTGCGCTCTGAGCTCATTTTCAGGAAGACATCATGTTCGAGTCCGTGTTCTCGTACTGCGGCAATTCTACAACTTTTCGGTCCTCCGTTTGAAATTCAACTGTCTGCCCCATGCAAATTTTCTATGGAACTTTGAGATTTGACGGCATGACTAAAGAGATCTCTCGCTTTTCCTCTTTCCTCTTAAGTCACCCAGGTAACAACTCCGATTCGCACATAATTTTCGCATGTTTAAAGCCTTGCCACTGAGCA

Full Affymetrix probeset data:

Annotations for 1634900_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720