FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634903_at:

>probe:Drosophila_2:1634903_at:348:681; Interrogation_Position=2621; Antisense; TATGGCTCTTCGACATCGTCTATAT
>probe:Drosophila_2:1634903_at:546:685; Interrogation_Position=2643; Antisense; TATCTCGTTTAGTTTCACTGTCCTG
>probe:Drosophila_2:1634903_at:10:77; Interrogation_Position=2693; Antisense; AGGAGACGCTGCTGAGTCATCCCGA
>probe:Drosophila_2:1634903_at:496:197; Interrogation_Position=2782; Antisense; AACGGATTTGTCCAGTGCTTCATCA
>probe:Drosophila_2:1634903_at:222:673; Interrogation_Position=2821; Antisense; TACGCCATGCTCAACGATGCGAATG
>probe:Drosophila_2:1634903_at:614:49; Interrogation_Position=2837; Antisense; ATGCGAATGTCCTCTTCAATGGCGG
>probe:Drosophila_2:1634903_at:725:573; Interrogation_Position=2857; Antisense; GGCGGACAGACTGCTAGCTTCCAGA
>probe:Drosophila_2:1634903_at:232:613; Interrogation_Position=2927; Antisense; TGAAATTGCTGCTAGTGGCCCACTA
>probe:Drosophila_2:1634903_at:209:581; Interrogation_Position=2942; Antisense; TGGCCCACTACATGACCTATCGGAA
>probe:Drosophila_2:1634903_at:30:611; Interrogation_Position=3005; Antisense; TGACCACGTATCTCTACAACCTGTA
>probe:Drosophila_2:1634903_at:191:83; Interrogation_Position=3034; Antisense; AGTGGCGAGCTGTACGATGTCTACA
>probe:Drosophila_2:1634903_at:200:441; Interrogation_Position=3049; Antisense; GATGTCTACAATCAGTTCCTCAGCT
>probe:Drosophila_2:1634903_at:438:719; Interrogation_Position=3077; Antisense; TTCCCATCTGGTTGTTCACGATCAT
>probe:Drosophila_2:1634903_at:525:711; Interrogation_Position=3091; Antisense; TTCACGATCATTTGCTCGGTGGCAT

Paste this into a BLAST search page for me
TATGGCTCTTCGACATCGTCTATATTATCTCGTTTAGTTTCACTGTCCTGAGGAGACGCTGCTGAGTCATCCCGAAACGGATTTGTCCAGTGCTTCATCATACGCCATGCTCAACGATGCGAATGATGCGAATGTCCTCTTCAATGGCGGGGCGGACAGACTGCTAGCTTCCAGATGAAATTGCTGCTAGTGGCCCACTATGGCCCACTACATGACCTATCGGAATGACCACGTATCTCTACAACCTGTAAGTGGCGAGCTGTACGATGTCTACAGATGTCTACAATCAGTTCCTCAGCTTTCCCATCTGGTTGTTCACGATCATTTCACGATCATTTGCTCGGTGGCAT

Full Affymetrix probeset data:

Annotations for 1634903_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720