FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634906_at:

>probe:Drosophila_2:1634906_at:164:275; Interrogation_Position=3085; Antisense; CTTGAGGGCAGTTAGAGCTTAGATC
>probe:Drosophila_2:1634906_at:152:645; Interrogation_Position=3108; Antisense; TCTAGACCTAGATCATGCACAGCCC
>probe:Drosophila_2:1634906_at:280:321; Interrogation_Position=3137; Antisense; GCCCGCCTGACCATATGCAATATAT
>probe:Drosophila_2:1634906_at:469:491; Interrogation_Position=3236; Antisense; GTAAATCCAATCCAATGAACTTTCG
>probe:Drosophila_2:1634906_at:83:61; Interrogation_Position=3267; Antisense; ATGGAGTTTCGTGTGTATTTTAATG
>probe:Drosophila_2:1634906_at:215:475; Interrogation_Position=3314; Antisense; GTAAAGTAATTGTTAAGCGGTCCAT
>probe:Drosophila_2:1634906_at:215:207; Interrogation_Position=3328; Antisense; AAGCGGTCCATACAATGTCCACAAG
>probe:Drosophila_2:1634906_at:432:249; Interrogation_Position=3340; Antisense; CAATGTCCACAAGTACTCTATTAAT
>probe:Drosophila_2:1634906_at:492:711; Interrogation_Position=3360; Antisense; TTAATTGTCCTCAATGCTCTTCCAC
>probe:Drosophila_2:1634906_at:152:619; Interrogation_Position=3374; Antisense; TGCTCTTCCACGTCAAAAAGCTTGA
>probe:Drosophila_2:1634906_at:201:117; Interrogation_Position=3392; Antisense; AGCTTGAGAAGCATATCGCCACTGA
>probe:Drosophila_2:1634906_at:118:377; Interrogation_Position=3399; Antisense; GAAGCATATCGCCACTGAAAATTGA
>probe:Drosophila_2:1634906_at:192:603; Interrogation_Position=3463; Antisense; TGTTCTTTTTATTTCCATTCAATTT
>probe:Drosophila_2:1634906_at:58:53; Interrogation_Position=3533; Antisense; ATGCATAGAGAAACACACCTTAAGT

Paste this into a BLAST search page for me
CTTGAGGGCAGTTAGAGCTTAGATCTCTAGACCTAGATCATGCACAGCCCGCCCGCCTGACCATATGCAATATATGTAAATCCAATCCAATGAACTTTCGATGGAGTTTCGTGTGTATTTTAATGGTAAAGTAATTGTTAAGCGGTCCATAAGCGGTCCATACAATGTCCACAAGCAATGTCCACAAGTACTCTATTAATTTAATTGTCCTCAATGCTCTTCCACTGCTCTTCCACGTCAAAAAGCTTGAAGCTTGAGAAGCATATCGCCACTGAGAAGCATATCGCCACTGAAAATTGATGTTCTTTTTATTTCCATTCAATTTATGCATAGAGAAACACACCTTAAGT

Full Affymetrix probeset data:

Annotations for 1634906_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720