Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634907_s_at:

>probe:Drosophila_2:1634907_s_at:624:605; Interrogation_Position=107; Antisense; TGAGACACAACCAACGTCTTTCCGA
>probe:Drosophila_2:1634907_s_at:398:495; Interrogation_Position=122; Antisense; GTCTTTCCGAAGATATCCCACAAGT
>probe:Drosophila_2:1634907_s_at:639:467; Interrogation_Position=145; Antisense; GTTGACAATGGATTCCTCATCGATA
>probe:Drosophila_2:1634907_s_at:582:463; Interrogation_Position=178; Antisense; GATTCGTTGGGAAGGTACGCACCCA
>probe:Drosophila_2:1634907_s_at:30:223; Interrogation_Position=189; Antisense; AAGGTACGCACCCATCTTTGTGGAC
>probe:Drosophila_2:1634907_s_at:681:307; Interrogation_Position=200; Antisense; CCATCTTTGTGGACTATCCGGGAAT
>probe:Drosophila_2:1634907_s_at:720:677; Interrogation_Position=214; Antisense; TATCCGGGAATTCAGCATTTGCTAA
>probe:Drosophila_2:1634907_s_at:589:363; Interrogation_Position=250; Antisense; GAATACGCATTGGATCTGCCGTTCG
>probe:Drosophila_2:1634907_s_at:496:545; Interrogation_Position=261; Antisense; GGATCTGCCGTTCGAGGACAAACAA
>probe:Drosophila_2:1634907_s_at:72:561; Interrogation_Position=293; Antisense; GGAAACTGGACCTGAGTCTTGAAAA
>probe:Drosophila_2:1634907_s_at:549:497; Interrogation_Position=308; Antisense; GTCTTGAAAATGATTCTGCTGCTAA
>probe:Drosophila_2:1634907_s_at:480:697; Interrogation_Position=66; Antisense; TTTCTCCGCGGAGTTGCCAGGAAAT
>probe:Drosophila_2:1634907_s_at:453:461; Interrogation_Position=78; Antisense; GTTGCCAGGAAATGCCTACTTGCCA
>probe:Drosophila_2:1634907_s_at:141:167; Interrogation_Position=87; Antisense; AAATGCCTACTTGCCACCGTTGAGA

Paste this into a BLAST search page for me
TGAGACACAACCAACGTCTTTCCGAGTCTTTCCGAAGATATCCCACAAGTGTTGACAATGGATTCCTCATCGATAGATTCGTTGGGAAGGTACGCACCCAAAGGTACGCACCCATCTTTGTGGACCCATCTTTGTGGACTATCCGGGAATTATCCGGGAATTCAGCATTTGCTAAGAATACGCATTGGATCTGCCGTTCGGGATCTGCCGTTCGAGGACAAACAAGGAAACTGGACCTGAGTCTTGAAAAGTCTTGAAAATGATTCTGCTGCTAATTTCTCCGCGGAGTTGCCAGGAAATGTTGCCAGGAAATGCCTACTTGCCAAAATGCCTACTTGCCACCGTTGAGA

Full Affymetrix probeset data:

Annotations for 1634907_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime