FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634909_at:

>probe:Drosophila_2:1634909_at:306:151; Interrogation_Position=128; Antisense; ACATACAACTTCTTGACCTCCGTGG
>probe:Drosophila_2:1634909_at:189:517; Interrogation_Position=170; Antisense; GTGGGATTTCCCCTGAAACTGACGA
>probe:Drosophila_2:1634909_at:656:423; Interrogation_Position=242; Antisense; GAGAGAATCCTTCCCAAGCTGGACT
>probe:Drosophila_2:1634909_at:341:119; Interrogation_Position=283; Antisense; AGCTGCTCAGGTGGCGGAACTCACA
>probe:Drosophila_2:1634909_at:153:363; Interrogation_Position=29; Antisense; GAATACAACGTGCACCGCAACTATT
>probe:Drosophila_2:1634909_at:565:155; Interrogation_Position=305; Antisense; ACAGAAGACATTCCTGCCGTTCAGC
>probe:Drosophila_2:1634909_at:591:341; Interrogation_Position=355; Antisense; GCTTTTGCAGAAGCTTCACCATCTG
>probe:Drosophila_2:1634909_at:86:97; Interrogation_Position=387; Antisense; AGATCGACGTGCTCGAGGGTCAACT
>probe:Drosophila_2:1634909_at:486:105; Interrogation_Position=423; Antisense; AGACAGGTCGTGTGTTTCCCATCAG
>probe:Drosophila_2:1634909_at:360:483; Interrogation_Position=453; Antisense; GTATACCAAACATGCTCCTTAACGA
>probe:Drosophila_2:1634909_at:321:537; Interrogation_Position=484; Antisense; GGTCTAGATTACACCCATGTGCTTT
>probe:Drosophila_2:1634909_at:394:507; Interrogation_Position=502; Antisense; GTGCTTTTTGTACCATAATCCCCAT
>probe:Drosophila_2:1634909_at:523:305; Interrogation_Position=532; Antisense; CCTTTCTCCAGACGCGCATTAATAT
>probe:Drosophila_2:1634909_at:416:5; Interrogation_Position=64; Antisense; ATTGTTGTTTACCTCATCTCTTTGT

Paste this into a BLAST search page for me
ACATACAACTTCTTGACCTCCGTGGGTGGGATTTCCCCTGAAACTGACGAGAGAGAATCCTTCCCAAGCTGGACTAGCTGCTCAGGTGGCGGAACTCACAGAATACAACGTGCACCGCAACTATTACAGAAGACATTCCTGCCGTTCAGCGCTTTTGCAGAAGCTTCACCATCTGAGATCGACGTGCTCGAGGGTCAACTAGACAGGTCGTGTGTTTCCCATCAGGTATACCAAACATGCTCCTTAACGAGGTCTAGATTACACCCATGTGCTTTGTGCTTTTTGTACCATAATCCCCATCCTTTCTCCAGACGCGCATTAATATATTGTTGTTTACCTCATCTCTTTGT

Full Affymetrix probeset data:

Annotations for 1634909_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720