FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634912_at:

>probe:Drosophila_2:1634912_at:628:547; Interrogation_Position=1704; Antisense; GGAGGGCCATTCTTGTGACGAACTT
>probe:Drosophila_2:1634912_at:382:409; Interrogation_Position=1720; Antisense; GACGAACTTGACTTCAGATGCTACT
>probe:Drosophila_2:1634912_at:385:97; Interrogation_Position=1735; Antisense; AGATGCTACTGAAGCCGACCTGCGG
>probe:Drosophila_2:1634912_at:188:319; Interrogation_Position=1748; Antisense; GCCGACCTGCGGAAAGTGTTTAACG
>probe:Drosophila_2:1634912_at:306:435; Interrogation_Position=1838; Antisense; GAGGGTTTCTGCAAATCTTTCTTGG
>probe:Drosophila_2:1634912_at:56:343; Interrogation_Position=1872; Antisense; GCATTGTAAACAACGCCCCTATATT
>probe:Drosophila_2:1634912_at:94:201; Interrogation_Position=1883; Antisense; AACGCCCCTATATTTATTGAGCCAA
>probe:Drosophila_2:1634912_at:184:691; Interrogation_Position=1897; Antisense; TATTGAGCCAAACTCTCTGCTGAAG
>probe:Drosophila_2:1634912_at:189:199; Interrogation_Position=1938; Antisense; AACGCTTAGCTATTGGTCAGACCCG
>probe:Drosophila_2:1634912_at:346:253; Interrogation_Position=2020; Antisense; CAAGCGCCCGGCACAAGAGAATGGT
>probe:Drosophila_2:1634912_at:129:91; Interrogation_Position=2114; Antisense; AGTACCATAAATACGGCCACAGCCC
>probe:Drosophila_2:1634912_at:637:123; Interrogation_Position=2134; Antisense; AGCCCCGATAATTCCATACAACTTG
>probe:Drosophila_2:1634912_at:542:129; Interrogation_Position=2202; Antisense; ACCGGAGAAATGCTAGCCGTATTCA
>probe:Drosophila_2:1634912_at:338:317; Interrogation_Position=2217; Antisense; GCCGTATTCAAGCAGATGTCGATTT

Paste this into a BLAST search page for me
GGAGGGCCATTCTTGTGACGAACTTGACGAACTTGACTTCAGATGCTACTAGATGCTACTGAAGCCGACCTGCGGGCCGACCTGCGGAAAGTGTTTAACGGAGGGTTTCTGCAAATCTTTCTTGGGCATTGTAAACAACGCCCCTATATTAACGCCCCTATATTTATTGAGCCAATATTGAGCCAAACTCTCTGCTGAAGAACGCTTAGCTATTGGTCAGACCCGCAAGCGCCCGGCACAAGAGAATGGTAGTACCATAAATACGGCCACAGCCCAGCCCCGATAATTCCATACAACTTGACCGGAGAAATGCTAGCCGTATTCAGCCGTATTCAAGCAGATGTCGATTT

Full Affymetrix probeset data:

Annotations for 1634912_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720