FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634916_at:

>probe:Drosophila_2:1634916_at:460:697; Interrogation_Position=2818; Antisense; TTTCATAACTCTTCACCGTCTAGAG
>probe:Drosophila_2:1634916_at:429:21; Interrogation_Position=2862; Antisense; ATATTGCTGCCTTTCGTTCGACATT
>probe:Drosophila_2:1634916_at:508:471; Interrogation_Position=2877; Antisense; GTTCGACATTGCCTCAGTCTCAGTC
>probe:Drosophila_2:1634916_at:613:87; Interrogation_Position=2892; Antisense; AGTCTCAGTCTCAACATGAATCATT
>probe:Drosophila_2:1634916_at:344:55; Interrogation_Position=2964; Antisense; ATGAAAATATCCGTAACAGTCCTTT
>probe:Drosophila_2:1634916_at:44:91; Interrogation_Position=2998; Antisense; AGTTTCCATATACTAGACTACCAAA
>probe:Drosophila_2:1634916_at:161:659; Interrogation_Position=3011; Antisense; TAGACTACCAAACAGAATACCCCTT
>probe:Drosophila_2:1634916_at:312:311; Interrogation_Position=3025; Antisense; GAATACCCCTTAATAGAGAGAACCT
>probe:Drosophila_2:1634916_at:19:427; Interrogation_Position=3040; Antisense; GAGAGAACCTCATCTCGAGATATAG
>probe:Drosophila_2:1634916_at:625:427; Interrogation_Position=3056; Antisense; GAGATATAGAACCATGACCACTGAA
>probe:Drosophila_2:1634916_at:397:173; Interrogation_Position=3085; Antisense; AAACCAATGTTAGAGCCAAGCTTTA
>probe:Drosophila_2:1634916_at:11:699; Interrogation_Position=3106; Antisense; TTTAGCAAACGTAAGCCAGAATCTG
>probe:Drosophila_2:1634916_at:692:89; Interrogation_Position=3195; Antisense; AGTAGTTTTCATATACCCCTCTATA
>probe:Drosophila_2:1634916_at:94:489; Interrogation_Position=3320; Antisense; GTACGTGTATATGTGTTACCAGGAT

Paste this into a BLAST search page for me
TTTCATAACTCTTCACCGTCTAGAGATATTGCTGCCTTTCGTTCGACATTGTTCGACATTGCCTCAGTCTCAGTCAGTCTCAGTCTCAACATGAATCATTATGAAAATATCCGTAACAGTCCTTTAGTTTCCATATACTAGACTACCAAATAGACTACCAAACAGAATACCCCTTGAATACCCCTTAATAGAGAGAACCTGAGAGAACCTCATCTCGAGATATAGGAGATATAGAACCATGACCACTGAAAAACCAATGTTAGAGCCAAGCTTTATTTAGCAAACGTAAGCCAGAATCTGAGTAGTTTTCATATACCCCTCTATAGTACGTGTATATGTGTTACCAGGAT

Full Affymetrix probeset data:

Annotations for 1634916_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720