FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634917_at:

>probe:Drosophila_2:1634917_at:571:69; Interrogation_Position=462; Antisense; AGGCCAAGGCTGTGGCTCTGCTGAA
>probe:Drosophila_2:1634917_at:552:571; Interrogation_Position=475; Antisense; GGCTCTGCTGAACGCCAAGAAGGTC
>probe:Drosophila_2:1634917_at:337:375; Interrogation_Position=505; Antisense; GAAGATCATCAAGGGCGCCTTCGGC
>probe:Drosophila_2:1634917_at:155:615; Interrogation_Position=582; Antisense; TGAAGCTGCCCAGGAGTCCCAAGTA
>probe:Drosophila_2:1634917_at:624:127; Interrogation_Position=626; Antisense; ACCAGGAACCGCATGGACGCGTACA
>probe:Drosophila_2:1634917_at:489:585; Interrogation_Position=639; Antisense; TGGACGCGTACAACATCATCAAGTA
>probe:Drosophila_2:1634917_at:320:215; Interrogation_Position=692; Antisense; AAGATCGAGGACAACAACACCCTGG
>probe:Drosophila_2:1634917_at:267:161; Interrogation_Position=741; Antisense; ACAAGAACCACGTGCGTGCCGCAGT
>probe:Drosophila_2:1634917_at:219:205; Interrogation_Position=770; Antisense; AAGCTCTACGACATCAAGGTGGCCA
>probe:Drosophila_2:1634917_at:129:581; Interrogation_Position=789; Antisense; TGGCCAAGGTGAACGTGCTCATCCG
>probe:Drosophila_2:1634917_at:61:211; Interrogation_Position=827; Antisense; AAGAAGGCCTATGTGCGCCTGGCGC
>probe:Drosophila_2:1634917_at:472:451; Interrogation_Position=883; Antisense; GATCGGCATCATATAAGCGCTGCAA
>probe:Drosophila_2:1634917_at:541:123; Interrogation_Position=898; Antisense; AGCGCTGCAATCTGCGGTAACGTGT
>probe:Drosophila_2:1634917_at:566:523; Interrogation_Position=928; Antisense; GGGCATCGCGTTCTACATTTTATAT

Paste this into a BLAST search page for me
AGGCCAAGGCTGTGGCTCTGCTGAAGGCTCTGCTGAACGCCAAGAAGGTCGAAGATCATCAAGGGCGCCTTCGGCTGAAGCTGCCCAGGAGTCCCAAGTAACCAGGAACCGCATGGACGCGTACATGGACGCGTACAACATCATCAAGTAAAGATCGAGGACAACAACACCCTGGACAAGAACCACGTGCGTGCCGCAGTAAGCTCTACGACATCAAGGTGGCCATGGCCAAGGTGAACGTGCTCATCCGAAGAAGGCCTATGTGCGCCTGGCGCGATCGGCATCATATAAGCGCTGCAAAGCGCTGCAATCTGCGGTAACGTGTGGGCATCGCGTTCTACATTTTATAT

Full Affymetrix probeset data:

Annotations for 1634917_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720