Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634918_a_at:

>probe:Drosophila_2:1634918_a_at:394:565; Interrogation_Position=284; Antisense; GGCAATGTACCCAAATCCTCGAAAA
>probe:Drosophila_2:1634918_a_at:423:537; Interrogation_Position=317; Antisense; GGTCAATATCCGGTGGGTCCCTGGC
>probe:Drosophila_2:1634918_a_at:491:333; Interrogation_Position=349; Antisense; GCTGTTCATCTTTGTGGTCTGCGGC
>probe:Drosophila_2:1634918_a_at:212:573; Interrogation_Position=371; Antisense; GGCTCTGCCATTTTCCAGATTGTTC
>probe:Drosophila_2:1634918_a_at:620:95; Interrogation_Position=387; Antisense; AGATTGTTCAGTCGATACGCGCCGC
>probe:Drosophila_2:1634918_a_at:543:393; Interrogation_Position=417; Antisense; GAAAGGCTTCACCTCGCATAAGATA
>probe:Drosophila_2:1634918_a_at:109:381; Interrogation_Position=486; Antisense; GAACCTTCACTTGCTACTACTAACA
>probe:Drosophila_2:1634918_a_at:328:669; Interrogation_Position=503; Antisense; TACTAACACCTTCCCTAGCTTAATA
>probe:Drosophila_2:1634918_a_at:523:675; Interrogation_Position=518; Antisense; TAGCTTAATAGTCCCCGGCAACATG
>probe:Drosophila_2:1634918_a_at:141:545; Interrogation_Position=553; Antisense; GGATGACCCCAAACAACTTGGCTTT
>probe:Drosophila_2:1634918_a_at:630:117; Interrogation_Position=666; Antisense; AGCTCTGCAATGTGCATTCCTGCAA
>probe:Drosophila_2:1634918_a_at:512:9; Interrogation_Position=681; Antisense; ATTCCTGCAATTCTCTCCTAAGCAA
>probe:Drosophila_2:1634918_a_at:659:603; Interrogation_Position=714; Antisense; TGATCCCCGATCATTTATAGGCGAT
>probe:Drosophila_2:1634918_a_at:19:699; Interrogation_Position=748; Antisense; TTTAAGATGCTTCTCGGCGCAGTTT

Paste this into a BLAST search page for me
GGCAATGTACCCAAATCCTCGAAAAGGTCAATATCCGGTGGGTCCCTGGCGCTGTTCATCTTTGTGGTCTGCGGCGGCTCTGCCATTTTCCAGATTGTTCAGATTGTTCAGTCGATACGCGCCGCGAAAGGCTTCACCTCGCATAAGATAGAACCTTCACTTGCTACTACTAACATACTAACACCTTCCCTAGCTTAATATAGCTTAATAGTCCCCGGCAACATGGGATGACCCCAAACAACTTGGCTTTAGCTCTGCAATGTGCATTCCTGCAAATTCCTGCAATTCTCTCCTAAGCAATGATCCCCGATCATTTATAGGCGATTTTAAGATGCTTCTCGGCGCAGTTT

Full Affymetrix probeset data:

Annotations for 1634918_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime