Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634919_at:

>probe:Drosophila_2:1634919_at:363:663; Interrogation_Position=1549; Antisense; TAAAGCCCTTTGAGGTGGTGACCGG
>probe:Drosophila_2:1634919_at:701:137; Interrogation_Position=1576; Antisense; ACGAGTCGGCCTTTGTTCATCTGCA
>probe:Drosophila_2:1634919_at:378:39; Interrogation_Position=1594; Antisense; ATCTGCACGGTTCGCTTATTACTCA
>probe:Drosophila_2:1634919_at:424:703; Interrogation_Position=1609; Antisense; TTATTACTCAACACCTGCTGCAGTT
>probe:Drosophila_2:1634919_at:372:697; Interrogation_Position=1647; Antisense; TTTCTGGTCAACTGTATCCTCGATC
>probe:Drosophila_2:1634919_at:703:467; Interrogation_Position=1725; Antisense; GTTGACGCCTTCATGCAGAGCAAGT
>probe:Drosophila_2:1634919_at:602:307; Interrogation_Position=1784; Antisense; CCAGTTGGATGGCTTCTACGTAGAC
>probe:Drosophila_2:1634919_at:671:485; Interrogation_Position=1803; Antisense; GTAGACTTGGCCATCACTCGACATG
>probe:Drosophila_2:1634919_at:238:385; Interrogation_Position=1842; Antisense; GAACAGTGCTTTAAGGCCGCCCAAG
>probe:Drosophila_2:1634919_at:193:383; Interrogation_Position=1893; Antisense; GAACTGTTTTCCAAGGCCAATATGC
>probe:Drosophila_2:1634919_at:316:249; Interrogation_Position=1910; Antisense; CAATATGCTGAAGGGCTCACCACAC
>probe:Drosophila_2:1634919_at:183:257; Interrogation_Position=1930; Antisense; CACACGGTCGGATCATCTACACAAA
>probe:Drosophila_2:1634919_at:575:183; Interrogation_Position=1952; Antisense; AAAATACCGCCTGGACACGTACAAG
>probe:Drosophila_2:1634919_at:297:117; Interrogation_Position=1975; Antisense; AGCTTTCACCTACGCAATGGCAGGA

Paste this into a BLAST search page for me
TAAAGCCCTTTGAGGTGGTGACCGGACGAGTCGGCCTTTGTTCATCTGCAATCTGCACGGTTCGCTTATTACTCATTATTACTCAACACCTGCTGCAGTTTTTCTGGTCAACTGTATCCTCGATCGTTGACGCCTTCATGCAGAGCAAGTCCAGTTGGATGGCTTCTACGTAGACGTAGACTTGGCCATCACTCGACATGGAACAGTGCTTTAAGGCCGCCCAAGGAACTGTTTTCCAAGGCCAATATGCCAATATGCTGAAGGGCTCACCACACCACACGGTCGGATCATCTACACAAAAAAATACCGCCTGGACACGTACAAGAGCTTTCACCTACGCAATGGCAGGA

Full Affymetrix probeset data:

Annotations for 1634919_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime