FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634921_at:

>probe:Drosophila_2:1634921_at:204:221; Interrogation_Position=103; Antisense; AAGTGCATGGATTTGCCCACATCTC
>probe:Drosophila_2:1634921_at:66:39; Interrogation_Position=123; Antisense; ATCTCGCGGTCTCACCAAATATGAA
>probe:Drosophila_2:1634921_at:262:223; Interrogation_Position=196; Antisense; AAGGTCAGCCTGTTTCAGTTACCCA
>probe:Drosophila_2:1634921_at:156:415; Interrogation_Position=231; Antisense; GACCACCAGATTGCAGTGCTTTCAA
>probe:Drosophila_2:1634921_at:251:697; Interrogation_Position=250; Antisense; TTTCAACGGCGGGATGGCTATCGAC
>probe:Drosophila_2:1634921_at:121:571; Interrogation_Position=265; Antisense; GGCTATCGACCCTTTATGTACTACA
>probe:Drosophila_2:1634921_at:391:489; Interrogation_Position=282; Antisense; GTACTACATACTCTTTGATTTCTGC
>probe:Drosophila_2:1634921_at:89:139; Interrogation_Position=329; Antisense; ACGATTTGTCCTTCGAACGATTCAT
>probe:Drosophila_2:1634921_at:575:669; Interrogation_Position=38; Antisense; TACTGTTTCTATCTGTTCTGCTGCA
>probe:Drosophila_2:1634921_at:624:107; Interrogation_Position=425; Antisense; AGAAGTTCGCCCTGGATTTCACAAA
>probe:Drosophila_2:1634921_at:606:157; Interrogation_Position=445; Antisense; ACAAAGATCAGCATGCCGGTGCCCG
>probe:Drosophila_2:1634921_at:696:475; Interrogation_Position=488; Antisense; GTTTCACCTTTTACGCGTACGGCAT
>probe:Drosophila_2:1634921_at:115:347; Interrogation_Position=509; Antisense; GCATCGCTCGTACATTGACACAGGT
>probe:Drosophila_2:1634921_at:551:349; Interrogation_Position=60; Antisense; GCAGGATTCAATGGGCACTCGTCTC

Paste this into a BLAST search page for me
AAGTGCATGGATTTGCCCACATCTCATCTCGCGGTCTCACCAAATATGAAAAGGTCAGCCTGTTTCAGTTACCCAGACCACCAGATTGCAGTGCTTTCAATTTCAACGGCGGGATGGCTATCGACGGCTATCGACCCTTTATGTACTACAGTACTACATACTCTTTGATTTCTGCACGATTTGTCCTTCGAACGATTCATTACTGTTTCTATCTGTTCTGCTGCAAGAAGTTCGCCCTGGATTTCACAAAACAAAGATCAGCATGCCGGTGCCCGGTTTCACCTTTTACGCGTACGGCATGCATCGCTCGTACATTGACACAGGTGCAGGATTCAATGGGCACTCGTCTC

Full Affymetrix probeset data:

Annotations for 1634921_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720