FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634923_at:

>probe:Drosophila_2:1634923_at:278:683; Interrogation_Position=466; Antisense; TATCCCTCGTGTCCGTTGAGCAGCT
>probe:Drosophila_2:1634923_at:39:75; Interrogation_Position=554; Antisense; AGGACACGGAGAGCGAGCCCTATCA
>probe:Drosophila_2:1634923_at:401:277; Interrogation_Position=573; Antisense; CTATCACTTCTGTTCCGACGAGGAT
>probe:Drosophila_2:1634923_at:190:437; Interrogation_Position=592; Antisense; GAGGATCATAGCAGTCACACGCAAA
>probe:Drosophila_2:1634923_at:101:95; Interrogation_Position=623; Antisense; AGTTGCGACGCCATCAACATGGACA
>probe:Drosophila_2:1634923_at:130:37; Interrogation_Position=656; Antisense; ATCATGGCCTCGATCTGATGGAGCC
>probe:Drosophila_2:1634923_at:267:285; Interrogation_Position=670; Antisense; CTGATGGAGCCGTCCGTCAACGAGG
>probe:Drosophila_2:1634923_at:348:73; Interrogation_Position=692; Antisense; AGGACGCCGACCTGGAGGACGACCA
>probe:Drosophila_2:1634923_at:182:69; Interrogation_Position=716; Antisense; AGGCCGAATCGCAGCTGGACTCGTT
>probe:Drosophila_2:1634923_at:616:117; Interrogation_Position=766; Antisense; AGCTACAACAAGTGCTGTCGCTTCT
>probe:Drosophila_2:1634923_at:398:219; Interrogation_Position=814; Antisense; AAGTGCAACTCGGAGCGCGGTTCGC
>probe:Drosophila_2:1634923_at:685:609; Interrogation_Position=851; Antisense; TGAGCCGCATCAGCCAGATTAGCAG
>probe:Drosophila_2:1634923_at:159:677; Interrogation_Position=870; Antisense; TAGCAGGAACCTGGACGGCGGCTAT
>probe:Drosophila_2:1634923_at:218:289; Interrogation_Position=983; Antisense; CGGCGGCCATCAGAGTTCGAATTTT

Paste this into a BLAST search page for me
TATCCCTCGTGTCCGTTGAGCAGCTAGGACACGGAGAGCGAGCCCTATCACTATCACTTCTGTTCCGACGAGGATGAGGATCATAGCAGTCACACGCAAAAGTTGCGACGCCATCAACATGGACAATCATGGCCTCGATCTGATGGAGCCCTGATGGAGCCGTCCGTCAACGAGGAGGACGCCGACCTGGAGGACGACCAAGGCCGAATCGCAGCTGGACTCGTTAGCTACAACAAGTGCTGTCGCTTCTAAGTGCAACTCGGAGCGCGGTTCGCTGAGCCGCATCAGCCAGATTAGCAGTAGCAGGAACCTGGACGGCGGCTATCGGCGGCCATCAGAGTTCGAATTTT

Full Affymetrix probeset data:

Annotations for 1634923_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720