Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634924_at:

>probe:Drosophila_2:1634924_at:274:389; Interrogation_Position=5625; Antisense; GAAAACCAACACAAGCTGCAAAGGA
>probe:Drosophila_2:1634924_at:575:53; Interrogation_Position=5656; Antisense; ATGCACACACCATATGCTACTATAT
>probe:Drosophila_2:1634924_at:101:687; Interrogation_Position=5743; Antisense; TATAATTCATGCACGCGCAGCTGGC
>probe:Drosophila_2:1634924_at:101:577; Interrogation_Position=5765; Antisense; GGCGAAGATCCAGTTGCACTAATCT
>probe:Drosophila_2:1634924_at:157:89; Interrogation_Position=5791; Antisense; AGTACTTTGGAGTGCGATTCCGCAT
>probe:Drosophila_2:1634924_at:629:293; Interrogation_Position=5805; Antisense; CGATTCCGCATTGATCCTCAACGAT
>probe:Drosophila_2:1634924_at:196:495; Interrogation_Position=5842; Antisense; GTCAAGTCCATAACTGATCCGCAGT
>probe:Drosophila_2:1634924_at:338:633; Interrogation_Position=5859; Antisense; TCCGCAGTTCACACCACATATATAA
>probe:Drosophila_2:1634924_at:511:613; Interrogation_Position=5906; Antisense; TGAAAATTGCGGAACGCCTGCCGTT
>probe:Drosophila_2:1634924_at:365:421; Interrogation_Position=6008; Antisense; GAGCAATCAGGTTTGTGACGACGGA
>probe:Drosophila_2:1634924_at:124:415; Interrogation_Position=6062; Antisense; GACCAGAAATATACCGCCAGCTCTT
>probe:Drosophila_2:1634924_at:649:313; Interrogation_Position=6077; Antisense; GCCAGCTCTTCTTACTAATGGGAAT
>probe:Drosophila_2:1634924_at:316:91; Interrogation_Position=6105; Antisense; AGATTGGTTTTATCCGCAGCTTTTA
>probe:Drosophila_2:1634924_at:145:131; Interrogation_Position=6138; Antisense; ACGCCCGAGTTGTGTAATTTAAGCA

Paste this into a BLAST search page for me
GAAAACCAACACAAGCTGCAAAGGAATGCACACACCATATGCTACTATATTATAATTCATGCACGCGCAGCTGGCGGCGAAGATCCAGTTGCACTAATCTAGTACTTTGGAGTGCGATTCCGCATCGATTCCGCATTGATCCTCAACGATGTCAAGTCCATAACTGATCCGCAGTTCCGCAGTTCACACCACATATATAATGAAAATTGCGGAACGCCTGCCGTTGAGCAATCAGGTTTGTGACGACGGAGACCAGAAATATACCGCCAGCTCTTGCCAGCTCTTCTTACTAATGGGAATAGATTGGTTTTATCCGCAGCTTTTAACGCCCGAGTTGTGTAATTTAAGCA

Full Affymetrix probeset data:

Annotations for 1634924_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime