FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634925_at:

>probe:Drosophila_2:1634925_at:167:379; Interrogation_Position=1019; Antisense; GAAGCCAGCGTGGAGACTCTGTCCG
>probe:Drosophila_2:1634925_at:656:161; Interrogation_Position=1076; Antisense; AAATTCTGGCCGGACGACGAGCTAA
>probe:Drosophila_2:1634925_at:46:419; Interrogation_Position=1094; Antisense; GAGCTAAAGACACGTGCGCCCAACT
>probe:Drosophila_2:1634925_at:162:607; Interrogation_Position=1131; Antisense; TGAGTTCCCTAAACGTCCATATCGA
>probe:Drosophila_2:1634925_at:588:101; Interrogation_Position=1156; Antisense; AGAGCATGCCTATGGCAGCCGTACA
>probe:Drosophila_2:1634925_at:428:407; Interrogation_Position=1237; Antisense; GACTGGATTGGATCCGCACGGCGAA
>probe:Drosophila_2:1634925_at:259:197; Interrogation_Position=1295; Antisense; AACGGCGTTTGACCACGGACAGGAT
>probe:Drosophila_2:1634925_at:449:547; Interrogation_Position=1316; Antisense; GGATGACGCAACTTCTTGACGCAAC
>probe:Drosophila_2:1634925_at:583:609; Interrogation_Position=1332; Antisense; TGACGCAACTATCTCGTTCGAAGAC
>probe:Drosophila_2:1634925_at:226:469; Interrogation_Position=1347; Antisense; GTTCGAAGACTTTCCTCTTTTGTAG
>probe:Drosophila_2:1634925_at:106:481; Interrogation_Position=1404; Antisense; GTATTTTGACTCTGGCATTTGCGAT
>probe:Drosophila_2:1634925_at:250:543; Interrogation_Position=907; Antisense; GGATTTCCAGAACGGCGAGTGCTAC
>probe:Drosophila_2:1634925_at:251:643; Interrogation_Position=956; Antisense; TCTCCGTTCGAGAAGGTGCGTCATG
>probe:Drosophila_2:1634925_at:464:471; Interrogation_Position=991; Antisense; GTTCGAGGCGATCGTTAAGGCTCAT

Paste this into a BLAST search page for me
GAAGCCAGCGTGGAGACTCTGTCCGAAATTCTGGCCGGACGACGAGCTAAGAGCTAAAGACACGTGCGCCCAACTTGAGTTCCCTAAACGTCCATATCGAAGAGCATGCCTATGGCAGCCGTACAGACTGGATTGGATCCGCACGGCGAAAACGGCGTTTGACCACGGACAGGATGGATGACGCAACTTCTTGACGCAACTGACGCAACTATCTCGTTCGAAGACGTTCGAAGACTTTCCTCTTTTGTAGGTATTTTGACTCTGGCATTTGCGATGGATTTCCAGAACGGCGAGTGCTACTCTCCGTTCGAGAAGGTGCGTCATGGTTCGAGGCGATCGTTAAGGCTCAT

Full Affymetrix probeset data:

Annotations for 1634925_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720