FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634927_at:

>probe:Drosophila_2:1634927_at:267:681; Interrogation_Position=142; Antisense; TATGGAACCCTGCTACCTGGATGGA
>probe:Drosophila_2:1634927_at:426:343; Interrogation_Position=170; Antisense; GCTTGCGGGCTATTGGACATGACCA
>probe:Drosophila_2:1634927_at:398:105; Interrogation_Position=196; Antisense; AGACACTTCATCGAACTCTGGCTGA
>probe:Drosophila_2:1634927_at:373:5; Interrogation_Position=224; Antisense; ATTGGGTAATCTATGCACTGCTGCA
>probe:Drosophila_2:1634927_at:271:557; Interrogation_Position=250; Antisense; GGACTTGGAGTCCTCACGGATTTCC
>probe:Drosophila_2:1634927_at:661:671; Interrogation_Position=295; Antisense; TACGCTGGTCTCAAGCTTATCCTGT
>probe:Drosophila_2:1634927_at:711:309; Interrogation_Position=353; Antisense; CCAATCACCTGTTCAATCTGCTTAA
>probe:Drosophila_2:1634927_at:711:39; Interrogation_Position=368; Antisense; ATCTGCTTAACACGTACTCTATGGG
>probe:Drosophila_2:1634927_at:436:389; Interrogation_Position=392; Antisense; GAAAACTATGTCCAGTCGTCGAGAA
>probe:Drosophila_2:1634927_at:715:345; Interrogation_Position=513; Antisense; GCATATCACGGAGCCACGGATCAAT
>probe:Drosophila_2:1634927_at:23:465; Interrogation_Position=579; Antisense; GATTGCAAAGAATTCGGCCGACCAT
>probe:Drosophila_2:1634927_at:67:45; Interrogation_Position=602; Antisense; ATCGCCATCAGCATGAGAGCCCTAT
>probe:Drosophila_2:1634927_at:723:101; Interrogation_Position=617; Antisense; AGAGCCCTATGATGATTCATTCCCC
>probe:Drosophila_2:1634927_at:177:527; Interrogation_Position=680; Antisense; GGGAATCCATGCACAATGTCATCGA

Paste this into a BLAST search page for me
TATGGAACCCTGCTACCTGGATGGAGCTTGCGGGCTATTGGACATGACCAAGACACTTCATCGAACTCTGGCTGAATTGGGTAATCTATGCACTGCTGCAGGACTTGGAGTCCTCACGGATTTCCTACGCTGGTCTCAAGCTTATCCTGTCCAATCACCTGTTCAATCTGCTTAAATCTGCTTAACACGTACTCTATGGGGAAAACTATGTCCAGTCGTCGAGAAGCATATCACGGAGCCACGGATCAATGATTGCAAAGAATTCGGCCGACCATATCGCCATCAGCATGAGAGCCCTATAGAGCCCTATGATGATTCATTCCCCGGGAATCCATGCACAATGTCATCGA

Full Affymetrix probeset data:

Annotations for 1634927_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720