FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634931_at:

>probe:Drosophila_2:1634931_at:150:637; Interrogation_Position=1013; Antisense; TCTTGTAGTCTTGTAGTTCAGCTTT
>probe:Drosophila_2:1634931_at:670:471; Interrogation_Position=1028; Antisense; GTTCAGCTTTACTTCGGTTATCATT
>probe:Drosophila_2:1634931_at:148:453; Interrogation_Position=1089; Antisense; GATCTTGTTAGATTCTGCATCTTTA
>probe:Drosophila_2:1634931_at:412:571; Interrogation_Position=1116; Antisense; GGCTTCAGGCATTTTCTTGTGCTAT
>probe:Drosophila_2:1634931_at:104:689; Interrogation_Position=1141; Antisense; TATTTAGTCATCTGCTGTTCCCAAC
>probe:Drosophila_2:1634931_at:610:687; Interrogation_Position=1196; Antisense; TATTGATCTCCACGATCGACTGCAT
>probe:Drosophila_2:1634931_at:250:49; Interrogation_Position=1238; Antisense; ATCCAAATTTCGCTACTGCCAGATT
>probe:Drosophila_2:1634931_at:62:359; Interrogation_Position=1300; Antisense; GAAAATTCTGTTTGTTCGGTCCGCT
>probe:Drosophila_2:1634931_at:171:633; Interrogation_Position=1319; Antisense; TCCGCTTGCGATTTACACACACATT
>probe:Drosophila_2:1634931_at:2:233; Interrogation_Position=810; Antisense; AATGCAGCCTAGTTTTCAGTGCCTC
>probe:Drosophila_2:1634931_at:82:631; Interrogation_Position=833; Antisense; TCCATTCCTTTACGCCAGCAAAAGT
>probe:Drosophila_2:1634931_at:149:275; Interrogation_Position=882; Antisense; CATTGGCAGCAGTACTTCATTGTTA
>probe:Drosophila_2:1634931_at:548:239; Interrogation_Position=935; Antisense; AATAATGCATGCAGTCCATTCCCCA
>probe:Drosophila_2:1634931_at:611:9; Interrogation_Position=952; Antisense; ATTCCCCACTGGTTCTATAGTTTAT

Paste this into a BLAST search page for me
TCTTGTAGTCTTGTAGTTCAGCTTTGTTCAGCTTTACTTCGGTTATCATTGATCTTGTTAGATTCTGCATCTTTAGGCTTCAGGCATTTTCTTGTGCTATTATTTAGTCATCTGCTGTTCCCAACTATTGATCTCCACGATCGACTGCATATCCAAATTTCGCTACTGCCAGATTGAAAATTCTGTTTGTTCGGTCCGCTTCCGCTTGCGATTTACACACACATTAATGCAGCCTAGTTTTCAGTGCCTCTCCATTCCTTTACGCCAGCAAAAGTCATTGGCAGCAGTACTTCATTGTTAAATAATGCATGCAGTCCATTCCCCAATTCCCCACTGGTTCTATAGTTTAT

Full Affymetrix probeset data:

Annotations for 1634931_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720