Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634933_s_at:

>probe:Drosophila_2:1634933_s_at:540:117; Interrogation_Position=106; Antisense; AGCTTTCTGGCGGATGCCATGCACA
>probe:Drosophila_2:1634933_s_at:82:197; Interrogation_Position=139; Antisense; AACTGGCGACTGGAGCAGAGCATTT
>probe:Drosophila_2:1634933_s_at:53:273; Interrogation_Position=168; Antisense; CATTAACTGTGGATGCGGGCGGATT
>probe:Drosophila_2:1634933_s_at:687:331; Interrogation_Position=193; Antisense; GCGGCTGGAGTGTGCATCAACCTGA
>probe:Drosophila_2:1634933_s_at:496:161; Interrogation_Position=228; Antisense; ACAATTTGTTGGCTCCGTGCTGATT
>probe:Drosophila_2:1634933_s_at:170:153; Interrogation_Position=280; Antisense; ACAGGACTGCTTTGGCTGGCAGGTT
>probe:Drosophila_2:1634933_s_at:329:77; Interrogation_Position=300; Antisense; AGGTTACCTTCGGATAGCCCTCAAT
>probe:Drosophila_2:1634933_s_at:705:489; Interrogation_Position=348; Antisense; GTACTTCCAGGTGTGCAATGTGATC
>probe:Drosophila_2:1634933_s_at:676:31; Interrogation_Position=388; Antisense; ATAATGCTGAGGTCTCGACGCACCG
>probe:Drosophila_2:1634933_s_at:142:621; Interrogation_Position=428; Antisense; TGCTGCTTACCTTCGTGAACTGGAA
>probe:Drosophila_2:1634933_s_at:384:569; Interrogation_Position=464; Antisense; GGCATTTGTGGCTCGTCTTTTATAA
>probe:Drosophila_2:1634933_s_at:547:527; Interrogation_Position=494; Antisense; GGGAGCAGCTTTTGGGTCATCAGAA
>probe:Drosophila_2:1634933_s_at:401:605; Interrogation_Position=573; Antisense; TGATCCTTCTTTGGCCTCGAGGGAA
>probe:Drosophila_2:1634933_s_at:721:579; Interrogation_Position=83; Antisense; TGGCCAGGATGCTGATCGTGTCCAG

Paste this into a BLAST search page for me
AGCTTTCTGGCGGATGCCATGCACAAACTGGCGACTGGAGCAGAGCATTTCATTAACTGTGGATGCGGGCGGATTGCGGCTGGAGTGTGCATCAACCTGAACAATTTGTTGGCTCCGTGCTGATTACAGGACTGCTTTGGCTGGCAGGTTAGGTTACCTTCGGATAGCCCTCAATGTACTTCCAGGTGTGCAATGTGATCATAATGCTGAGGTCTCGACGCACCGTGCTGCTTACCTTCGTGAACTGGAAGGCATTTGTGGCTCGTCTTTTATAAGGGAGCAGCTTTTGGGTCATCAGAATGATCCTTCTTTGGCCTCGAGGGAATGGCCAGGATGCTGATCGTGTCCAG

Full Affymetrix probeset data:

Annotations for 1634933_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime