FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634934_at:

>probe:Drosophila_2:1634934_at:660:461; Interrogation_Position=2527; Antisense; GATTCAGCATACATATTCTGGAGGC
>probe:Drosophila_2:1634934_at:627:11; Interrogation_Position=2541; Antisense; ATTCTGGAGGCATAGACGCAGCGCA
>probe:Drosophila_2:1634934_at:245:725; Interrogation_Position=2572; Antisense; TTGACCCATGTTGGCACGCTCTAAA
>probe:Drosophila_2:1634934_at:346:627; Interrogation_Position=2609; Antisense; TGCCAAGCCCACACTTTTCAAAAAT
>probe:Drosophila_2:1634934_at:4:691; Interrogation_Position=2682; Antisense; TTTGACAAACAACTTTTTGCCACGC
>probe:Drosophila_2:1634934_at:475:691; Interrogation_Position=2697; Antisense; TTTGCCACGCCCAACGTCCTAAAAG
>probe:Drosophila_2:1634934_at:659:537; Interrogation_Position=2732; Antisense; GGTCACGCCCACAATTTCTAAATTT
>probe:Drosophila_2:1634934_at:11:727; Interrogation_Position=2755; Antisense; TTGTTCTCATTTTATTCGCGTTCGC
>probe:Drosophila_2:1634934_at:591:675; Interrogation_Position=2829; Antisense; TAGCATTCTCTCTTGCTTTCTTTAA
>probe:Drosophila_2:1634934_at:326:325; Interrogation_Position=2873; Antisense; GCGAAATTCGTTTGCTTAACCAGCG
>probe:Drosophila_2:1634934_at:714:707; Interrogation_Position=2888; Antisense; TTAACCAGCGCGAGGGTGGATCTTA
>probe:Drosophila_2:1634934_at:449:667; Interrogation_Position=2967; Antisense; TACTAGCTTAGGATGCTTCCGGTGC
>probe:Drosophila_2:1634934_at:706:77; Interrogation_Position=2976; Antisense; AGGATGCTTCCGGTGCTGACGCAAC
>probe:Drosophila_2:1634934_at:350:491; Interrogation_Position=3051; Antisense; GTAACCAATTCGTACAATGTCAAAG

Paste this into a BLAST search page for me
GATTCAGCATACATATTCTGGAGGCATTCTGGAGGCATAGACGCAGCGCATTGACCCATGTTGGCACGCTCTAAATGCCAAGCCCACACTTTTCAAAAATTTTGACAAACAACTTTTTGCCACGCTTTGCCACGCCCAACGTCCTAAAAGGGTCACGCCCACAATTTCTAAATTTTTGTTCTCATTTTATTCGCGTTCGCTAGCATTCTCTCTTGCTTTCTTTAAGCGAAATTCGTTTGCTTAACCAGCGTTAACCAGCGCGAGGGTGGATCTTATACTAGCTTAGGATGCTTCCGGTGCAGGATGCTTCCGGTGCTGACGCAACGTAACCAATTCGTACAATGTCAAAG

Full Affymetrix probeset data:

Annotations for 1634934_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720