Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634935_a_at:

>probe:Drosophila_2:1634935_a_at:269:5; Interrogation_Position=461; Antisense; ATTGACCAGGGTGTGAACCGTGCCG
>probe:Drosophila_2:1634935_a_at:675:287; Interrogation_Position=487; Antisense; CGGAGCCGTCAACCAAGGCAAGCAG
>probe:Drosophila_2:1634935_a_at:474:317; Interrogation_Position=548; Antisense; GCCCAGAACTCCAAGCAGGTGGCGG
>probe:Drosophila_2:1634935_a_at:719:297; Interrogation_Position=604; Antisense; CGCCAATGCGGTGGACCAGACCAAG
>probe:Drosophila_2:1634935_a_at:14:109; Interrogation_Position=672; Antisense; AGAACGTGGCGGACCAGAAGCTGAA
>probe:Drosophila_2:1634935_a_at:400:113; Interrogation_Position=729; Antisense; AGCAGACCAGTCAAACGGTGGACCA
>probe:Drosophila_2:1634935_a_at:160:77; Interrogation_Position=762; Antisense; AGGAGGCCAACCAGTATGTCGACCA
>probe:Drosophila_2:1634935_a_at:279:267; Interrogation_Position=773; Antisense; CAGTATGTCGACCAGAAGCGCCAGT
>probe:Drosophila_2:1634935_a_at:592:107; Interrogation_Position=786; Antisense; AGAAGCGCCAGTCCGTCGAGAAGAC
>probe:Drosophila_2:1634935_a_at:625:211; Interrogation_Position=806; Antisense; AAGACCGTCCAGGATGCGGCCGGAC
>probe:Drosophila_2:1634935_a_at:201:77; Interrogation_Position=837; Antisense; AGGAGTCTGCCGGACAGCAGGCCAA
>probe:Drosophila_2:1634935_a_at:368:603; Interrogation_Position=867; Antisense; TGTTGGGCAAGCTGCATCTGGGTCA
>probe:Drosophila_2:1634935_a_at:533:535; Interrogation_Position=887; Antisense; GGTCAGAAGTAGAGGCGTCTCCCTT
>probe:Drosophila_2:1634935_a_at:86:331; Interrogation_Position=913; Antisense; GCGGTGCCACCTAAAATATCTTGAT

Paste this into a BLAST search page for me
ATTGACCAGGGTGTGAACCGTGCCGCGGAGCCGTCAACCAAGGCAAGCAGGCCCAGAACTCCAAGCAGGTGGCGGCGCCAATGCGGTGGACCAGACCAAGAGAACGTGGCGGACCAGAAGCTGAAAGCAGACCAGTCAAACGGTGGACCAAGGAGGCCAACCAGTATGTCGACCACAGTATGTCGACCAGAAGCGCCAGTAGAAGCGCCAGTCCGTCGAGAAGACAAGACCGTCCAGGATGCGGCCGGACAGGAGTCTGCCGGACAGCAGGCCAATGTTGGGCAAGCTGCATCTGGGTCAGGTCAGAAGTAGAGGCGTCTCCCTTGCGGTGCCACCTAAAATATCTTGAT

Full Affymetrix probeset data:

Annotations for 1634935_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime