Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634936_at:

>probe:Drosophila_2:1634936_at:704:377; Interrogation_Position=15; Antisense; GAAGCTGTCCGCAGCATTCTACGGA
>probe:Drosophila_2:1634936_at:663:165; Interrogation_Position=160; Antisense; AAATCGGCAATATCCACGGCGACGG
>probe:Drosophila_2:1634936_at:304:43; Interrogation_Position=241; Antisense; ATCGAGCAGCTGCAACAGGCGTTAA
>probe:Drosophila_2:1634936_at:271:115; Interrogation_Position=27; Antisense; AGCATTCTACGGAGTTCGCTTTGTC
>probe:Drosophila_2:1634936_at:197:673; Interrogation_Position=286; Antisense; TATGCCCTGGAATCGGCCTGTTTGA
>probe:Drosophila_2:1634936_at:185:91; Interrogation_Position=365; Antisense; AGTACGATCGGCTCTACGAATCGCA
>probe:Drosophila_2:1634936_at:414:253; Interrogation_Position=435; Antisense; CAAGCTGGTGGATCGAAATGCCGGC
>probe:Drosophila_2:1634936_at:347:393; Interrogation_Position=460; Antisense; GAAAGGGCACAGTTGACCAGCGATG
>probe:Drosophila_2:1634936_at:488:595; Interrogation_Position=483; Antisense; TGTGGCCACTTTGAGTGTGCGACTC
>probe:Drosophila_2:1634936_at:499:563; Interrogation_Position=513; Antisense; GGCAAACTTCAACATCGCCAAGCTG
>probe:Drosophila_2:1634936_at:167:521; Interrogation_Position=53; Antisense; GGGCCTTTTCAGTGTTTTCAGTGCG
>probe:Drosophila_2:1634936_at:247:605; Interrogation_Position=536; Antisense; TGCAGAGGGAAATCCCCTTCGGGTT
>probe:Drosophila_2:1634936_at:617:83; Interrogation_Position=72; Antisense; AGTGCGGGTACTGCAGTCGAAACCG
>probe:Drosophila_2:1634936_at:459:501; Interrogation_Position=87; Antisense; GTCGAAACCGTGTGACACTCTGCGT

Paste this into a BLAST search page for me
GAAGCTGTCCGCAGCATTCTACGGAAAATCGGCAATATCCACGGCGACGGATCGAGCAGCTGCAACAGGCGTTAAAGCATTCTACGGAGTTCGCTTTGTCTATGCCCTGGAATCGGCCTGTTTGAAGTACGATCGGCTCTACGAATCGCACAAGCTGGTGGATCGAAATGCCGGCGAAAGGGCACAGTTGACCAGCGATGTGTGGCCACTTTGAGTGTGCGACTCGGCAAACTTCAACATCGCCAAGCTGGGGCCTTTTCAGTGTTTTCAGTGCGTGCAGAGGGAAATCCCCTTCGGGTTAGTGCGGGTACTGCAGTCGAAACCGGTCGAAACCGTGTGACACTCTGCGT

Full Affymetrix probeset data:

Annotations for 1634936_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime