Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634939_at:

>probe:Drosophila_2:1634939_at:170:21; Interrogation_Position=1019; Antisense; ATATCGTTGGTCCTGTCGAGCTACG
>probe:Drosophila_2:1634939_at:673:339; Interrogation_Position=1038; Antisense; GCTACGGACCGATGAAGGCACTCTA
>probe:Drosophila_2:1634939_at:101:49; Interrogation_Position=570; Antisense; ATGCCTGGCTAGTGACCATCGGGTT
>probe:Drosophila_2:1634939_at:403:647; Interrogation_Position=618; Antisense; TCATGATCCACTACGGCGGCAATGT
>probe:Drosophila_2:1634939_at:168:105; Interrogation_Position=666; Antisense; AGACGAAGACCACCATTCACTGGGT
>probe:Drosophila_2:1634939_at:634:645; Interrogation_Position=682; Antisense; TCACTGGGTGCTCCTGACTTTGGGA
>probe:Drosophila_2:1634939_at:240:697; Interrogation_Position=755; Antisense; TTTTTGCTGCAATCGACACATGGGA
>probe:Drosophila_2:1634939_at:502:715; Interrogation_Position=797; Antisense; TTCGTACTGTGCATTCTGGCCATGT
>probe:Drosophila_2:1634939_at:713:377; Interrogation_Position=859; Antisense; GAAGCTAATCACACCATTGCTGAAC
>probe:Drosophila_2:1634939_at:209:385; Interrogation_Position=880; Antisense; GAACAAGACGTTCCACAACTTCCTG
>probe:Drosophila_2:1634939_at:365:191; Interrogation_Position=896; Antisense; AACTTCCTGGGATTCGCGTGCTTTG
>probe:Drosophila_2:1634939_at:551:341; Interrogation_Position=915; Antisense; GCTTTGTGATCGCACTGGTGACCCA
>probe:Drosophila_2:1634939_at:279:533; Interrogation_Position=931; Antisense; GGTGACCCAGTACTATGGCTACCAG
>probe:Drosophila_2:1634939_at:457:681; Interrogation_Position=944; Antisense; TATGGCTACCAGACGGGCTACTTTA

Paste this into a BLAST search page for me
ATATCGTTGGTCCTGTCGAGCTACGGCTACGGACCGATGAAGGCACTCTAATGCCTGGCTAGTGACCATCGGGTTTCATGATCCACTACGGCGGCAATGTAGACGAAGACCACCATTCACTGGGTTCACTGGGTGCTCCTGACTTTGGGATTTTTGCTGCAATCGACACATGGGATTCGTACTGTGCATTCTGGCCATGTGAAGCTAATCACACCATTGCTGAACGAACAAGACGTTCCACAACTTCCTGAACTTCCTGGGATTCGCGTGCTTTGGCTTTGTGATCGCACTGGTGACCCAGGTGACCCAGTACTATGGCTACCAGTATGGCTACCAGACGGGCTACTTTA

Full Affymetrix probeset data:

Annotations for 1634939_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime