FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634940_at:

>probe:Drosophila_2:1634940_at:645:539; Interrogation_Position=1004; Antisense; GGTATTCCCGGCATGAAGTTCGAGA
>probe:Drosophila_2:1634940_at:482:683; Interrogation_Position=1040; Antisense; TATGCGGATGTGATTGCCACGCTGC
>probe:Drosophila_2:1634940_at:476:45; Interrogation_Position=1071; Antisense; ATGCCGCGAAGGTGGTCTACGTTGA
>probe:Drosophila_2:1634940_at:103:321; Interrogation_Position=1144; Antisense; GCCCCACATTATTCGATTCCTGAAG
>probe:Drosophila_2:1634940_at:380:85; Interrogation_Position=1233; Antisense; AGTGTATTTCATCCCACTTGTGATG
>probe:Drosophila_2:1634940_at:453:513; Interrogation_Position=1262; Antisense; GTGATCAAAGGTATGTGCCCGATTT
>probe:Drosophila_2:1634940_at:716:625; Interrogation_Position=1277; Antisense; TGCCCGATTTGCACGGCTCTAAATG
>probe:Drosophila_2:1634940_at:55:587; Interrogation_Position=738; Antisense; TGGACTACGAAACCCTGCCGGAGAG
>probe:Drosophila_2:1634940_at:658:255; Interrogation_Position=796; Antisense; CAAACTGGTGCTGGACGCGTACGAT
>probe:Drosophila_2:1634940_at:524:671; Interrogation_Position=815; Antisense; TACGATGGGTCCGTGGATGAGCCTT
>probe:Drosophila_2:1634940_at:657:125; Interrogation_Position=834; Antisense; AGCCTTCGGTTCGTGTGCTCATGAA
>probe:Drosophila_2:1634940_at:363:109; Interrogation_Position=885; Antisense; AGAATGGCTACCTCTTTGCCAGGGA
>probe:Drosophila_2:1634940_at:664:217; Interrogation_Position=921; Antisense; AAGTAAGCCTGCTGGGCATGTTCAC
>probe:Drosophila_2:1634940_at:554:59; Interrogation_Position=938; Antisense; ATGTTCACCGCCGAGCAGACGTTGG

Paste this into a BLAST search page for me
GGTATTCCCGGCATGAAGTTCGAGATATGCGGATGTGATTGCCACGCTGCATGCCGCGAAGGTGGTCTACGTTGAGCCCCACATTATTCGATTCCTGAAGAGTGTATTTCATCCCACTTGTGATGGTGATCAAAGGTATGTGCCCGATTTTGCCCGATTTGCACGGCTCTAAATGTGGACTACGAAACCCTGCCGGAGAGCAAACTGGTGCTGGACGCGTACGATTACGATGGGTCCGTGGATGAGCCTTAGCCTTCGGTTCGTGTGCTCATGAAAGAATGGCTACCTCTTTGCCAGGGAAAGTAAGCCTGCTGGGCATGTTCACATGTTCACCGCCGAGCAGACGTTGG

Full Affymetrix probeset data:

Annotations for 1634940_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720