FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634942_at:

>probe:Drosophila_2:1634942_at:636:139; Interrogation_Position=1010; Antisense; ACGGAATTGAGTGTCTGGCCTTTGC
>probe:Drosophila_2:1634942_at:61:545; Interrogation_Position=1047; Antisense; GGATCTAAAGCTCTTTGCCTGTGGC
>probe:Drosophila_2:1634942_at:592:407; Interrogation_Position=1078; Antisense; GACGGCAGGATATCCATCTGGGACT
>probe:Drosophila_2:1634942_at:229:35; Interrogation_Position=1110; Antisense; ATCAGCGTTGCGTACCATATGCGAA
>probe:Drosophila_2:1634942_at:347:235; Interrogation_Position=1135; Antisense; AATCCAGTTCCCAATGATGCTGTCA
>probe:Drosophila_2:1634942_at:725:719; Interrogation_Position=1174; Antisense; TTGAACGACCACACGATACTTGCGG
>probe:Drosophila_2:1634942_at:77:395; Interrogation_Position=1211; Antisense; GAAATCTGAACGCATTCGACGCACG
>probe:Drosophila_2:1634942_at:44:719; Interrogation_Position=1225; Antisense; TTCGACGCACGCACAGGAATTCTGA
>probe:Drosophila_2:1634942_at:553:393; Interrogation_Position=1248; Antisense; GAAATTCACGCTGACGGGACACTAC
>probe:Drosophila_2:1634942_at:678:527; Interrogation_Position=1263; Antisense; GGGACACTACTATCACATCTACGAG
>probe:Drosophila_2:1634942_at:653:215; Interrogation_Position=1345; Antisense; AAGATATTCAAGGTGCCGGCGCTGG
>probe:Drosophila_2:1634942_at:18:297; Interrogation_Position=869; Antisense; CGCATCCAATGGGTTTCGGCGAGAT
>probe:Drosophila_2:1634942_at:709:231; Interrogation_Position=960; Antisense; AATGCTGTTCTGCACTAACAACGGT
>probe:Drosophila_2:1634942_at:502:195; Interrogation_Position=979; Antisense; AACGGTCCGGTTAGCACAATCCAGT

Paste this into a BLAST search page for me
ACGGAATTGAGTGTCTGGCCTTTGCGGATCTAAAGCTCTTTGCCTGTGGCGACGGCAGGATATCCATCTGGGACTATCAGCGTTGCGTACCATATGCGAAAATCCAGTTCCCAATGATGCTGTCATTGAACGACCACACGATACTTGCGGGAAATCTGAACGCATTCGACGCACGTTCGACGCACGCACAGGAATTCTGAGAAATTCACGCTGACGGGACACTACGGGACACTACTATCACATCTACGAGAAGATATTCAAGGTGCCGGCGCTGGCGCATCCAATGGGTTTCGGCGAGATAATGCTGTTCTGCACTAACAACGGTAACGGTCCGGTTAGCACAATCCAGT

Full Affymetrix probeset data:

Annotations for 1634942_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720